Vriesea rubra

(Ruiz & Pav.) Beer · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Vriesea

At a glance

Occurrence records109

Data sources6

Biological traits10

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Vriesea rubra's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility109 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF109 records

DNA & barcodingNCBIsequences

01Narrative

Tillandsia rubra (Vriesea rubra) air plants in a UK air plant nursery Vriesea rubra is a plant species in the genus Vriesea. This species is native to Trinidad and northern South America (Colombia, Ecuador, Peru, Guyana, northern Brazil, and Venezuela).Kew World Checklist of Selected Plant Families

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTTRY

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climberself-supporting

Elevation max1 400 m

Elevation mean850 m

Elevation min250 m

Epiphyteobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta de Terra Firme

Woodinessnon-woody

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vriesea rubra has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

matKKX754209.1 ↗1 853 bp

ACGT

TATGTATCATTTGATAAACCAAGAAAAACCTCCTGCCTCTGGCTCAAGTAGAAATGTAAATGGAAGAATTACAAGGATATTTAGAAAAAG …

Vriesea rubra isolate B983 trnK-UUU gene, partial sequence; and maturase K (matK) gene, complete cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1

plant barcode

08Occurrence & distribution

Record type109 records

Wild obs. + sensor17

Museum / vouchered91

Cultivated / captive1

Range

Area of Occupancy AOO256 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the mapobservation + sensor17

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy44% within 1 km

≤100 m 1≤1 km 7≤10 km 9>10 km 1

18 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence91

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Saint Louis, US	17
Universidad Nacional de Colombia (UNAL)location not on record	16
Chicago, US	8
Universidad de Antioquia (UdeA)location not on record	8
University of Stellenboschlocation not on record	8
Bronx, US	6
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	5
St. Augustine, TT	4
Tampa, US	3
Fundación Jardín Botánico Joaquín Antonio Uribe de Medellínlocation not on record	2
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Kew, GB	2
Pontificia Universidad Javeriana (PUJ)location not on record	1
Universiti Sains Malaysialocation not on record	1
Universidad de los Llanos (UniLlanos)location not on record	1
HUAlocation not on record	1
Station d'Ecologie de Lamtolocation not on record	1
Madison, US	1
Wlocation not on record	1

19 institutions · 88 of 91 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)