Vriesea gigantea

Gaudich. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Vriesea

At a glance

Occurrence records493

Data sources7

Biological traits12

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Vriesea gigantea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility493 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF493 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Vriesea gigantea é uma espécie de planta do gênero Vriesea. Esta espécie é endêmica da mata atlântica e pode ser encontrada desde o Rio Grande do Sul até o Espírito Santo. A espécie consta como quase ameaçada no estado do Rio Grande do Sul, conforme decreto publicado no Diário Oficial do Estado em 2014.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction2

Life formepiphyte

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max500 m

Elevation min0 m

Epiphytefacultative

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTFloresta Ombrófila (= Floresta Pluvial)

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vriesea gigantea has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJN202193.1 ↗632 bp

ACGT

TACAAATTGACTTATTATACTCCTGACTACGAAACCAAGGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Vriesea gigantea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

08Occurrence & distribution

Record type493 records

Wild obs. + sensor374

Museum / vouchered118

Other1

Origin

Native46

Range

Area of Occupancy AOO1 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 193≤1 km 59≤10 km 27>10 km 19

298 georeferenced · 76 without coordinates

Open the mapobservation + sensor374

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 117 without coordinates

Open the institutions mapphysical evidence118

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 28 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Blumenau, BR	34
San Jose State University, Museum of Birds and Mammalslocation not on record	9
Bronx, US	8
Porto Alegre, BR	8
Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record	7
Universidade Federal do Vale do São Franciscolocation not on record	4
UNESP-RClocation not on record	4
IAPlocation not on record	4
Université de Bordeauxlocation not on record	4
UNESClocation not on record	4
JBRJlocation not on record	4
Criciúma, BR	3
Universidade Federal do Rio Grande do Nortelocation not on record	3
Universidade Federal de Santa Catarinalocation not on record	2
Chicago, US	2
Cruz das Almas, BR	2
UFSClocation not on record	2
University of Stellenboschlocation not on record	2
Lake Charles, US	2
UNIVILLElocation not on record	2
Universidade Federale do Rio Grande do Sullocation not on record	1
UNICAMPlocation not on record	1
UFMGlocation not on record	1
LDlocation not on record	1
Pontifícia Universidade Católica do Paranálocation not on record	1
UFRRJlocation not on record	1
Campo Mourão, BR	1
UTFPR-CPlocation not on record	1

28 institutions · 118 of 118 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Vriesea gigantea was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)