Voria ruralis

(Fallén, 1810) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Tachinidae/Voria

At a glance

Occurrence records2 369

Data sources7

Biological traits0

DNA specimens57

eDNA detections676

Sources7 archives

Databases and archives Voria ruralis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 369 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI676 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF2 369 records

Environmental DNA3 datasets · 12 countries676 detections

DNA & barcodingBOLD57 specimens

01Narrative

Voria ruralis is a species of fly in the family Tachinidae.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Voria ruralis has left across the world's sequence archives.

At a glance

DNA specimens57

BINs5

Marker genes2

eDNA detections676

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P655 bp consensus52 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

47Cmostly conserved

89Cmostly conserved

108Avariable

113Cmostly conserved

152Tmostly conserved

185Tmostly conserved

200Tmostly conserved

203Tmostly conserved

210Cmostly conserved

221Tmostly conserved

233Tmostly conserved

266Tmostly conserved

276Cmostly conserved

290Gmostly conserved

296Amostly conserved

350Amostly conserved

401Amostly conserved

428Gmostly conserved

443Tmostly conserved

455Amostly conserved

518Amostly conserved

524Tmostly conserved

551Cmostly conserved

576Cmostly conserved

602Tvariable

CTTTATATTTTATTTTTGGAGCTTGATCAGGAATAGTAGGAACATCCCTTAGAATATTAATTCGATTTGAATTAGGTCATCCAGGAGCCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.5%

Haplotypes10

BINs5

Most divergent pair18.5%

EuropeN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Schembria eldanasame family4.0%Voria erasmocoronadoisame genus4.4%Cowania wheelerisame family8.9%Cyrtophloeba vernalissame family9.0%Gaurax maculipennissame order9.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type2 369 records

Wild obs. + sensor2 025

Museum / vouchered305

Cultivated / captive3

Other36

Range

Area of Occupancy AOO5 052 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 1 039≤1 km 316≤10 km 379>10 km 24

1 758 georeferenced · 267 without coordinates

Open the mapobservation + sensor2 025

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy91% within 1 km

≤100 m 175≤1 km 65≤10 km 23

263 georeferenced · 42 without coordinates

Open the institutions mapphysical evidence305

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 3 records without

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions8 of 29 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
SLU Artdatabankenlocation not on record	28
NHMOlocation not on record	26
KwaZulu-Natal Museumlocation not on record	14
University of Tokyo, Department of Zoologylocation not on record	13
Helsinki, FI	12
Iwate Prefectural Museumlocation not on record	11
European Distributed Institute of Taxonomy (EDIT)location not on record	10
Metsähallituslocation not on record	9
University of Guelphlocation not on record	8
South Kensington, GB	7
Museo Entomologico de Leonlocation not on record	6
The University of the West Indies, Trinidad and Tobagolocation not on record	4
NCMGlocation not on record	4
Provincia di Livornolocation not on record	4
Gothenburg, SE	2
CBDClocation not on record	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	2
Norwegian Institute for Nature Researchlocation not on record	2
neflocation not on record	2
Sydney, AU	2
Natural History Museum of Utahlocation not on record	1
Tromsø, NO	1
CUlocation not on record	1
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
US	1
Natural History Museum, Londonlocation not on record	1
Cape Town, ZA	1
NMOKlocation not on record	1
Ghent, BE	1

29 institutions · 177 of 305 vouchered records shown · 128 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA676 detections

Where the DNA of Voria ruralis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found676

Studies independent surveys3

Countries12

Verifiable raw sequence linked258

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 676 detections have coordinates

Open the map12 countries0

1. Forest & Woodland4. Native Grassland|4.2 Subarctic Grassland1. Forest & Woodland | 1.4. Temperate Forest1. Forest & Woodland|1.1. Boreal Forest4. Native Grassland|4.1. TundraAgricultural

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.7 °C 10.4–18.1

Seasonal swing summer↔winter19.8 °C

Max temp (day)19.9 °C 14.7–25.5

Min temp (night)11.4 °C 6.50–13.8

Precipitation70.6 mm/mo 12.5–116

Air humidity59.5 % 45.9–63.5

Moisture balance-35.7 mm/mo -145–31.9

Vapour deficit716 Pa 487–1,043

Wind speed2.90 m/s 1.80–4.20

Cloud cover42.5 % 29.0–55.1

CHELSA 1981–2010, ~9 km grid, at location & month of 666 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Voria ruralis

At a glance

Sources7 archives

At a glance

Record type2 369 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions8 of 29 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 369 records