Volvariella surrecta

(Knapp) Singer · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Agaricomycetes/Agaricales/Pluteaceae/Volvariella

At a glance

Occurrence records1 265

Data sources10

Biological traits0

DNA specimens1

eDNA detections11

Sources10 archives

Databases and archives Volvariella surrecta's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 265 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 265 records

Environmental DNA2 datasets · 2 countries11 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceGoaT · NCBI≈28 Mbp

01Narrative

Volvariella surrecta, commonly known as the piggyback rosegill, is an agaric fungus in the family Pluteaceae. Although rare, the species is widely distributed, having been reported from Asia, North America, Northern Africa, Europe, and New Zealand. The fungus grows as a parasite on the fruit bodies of other gilled mushrooms, usually Clitocybe nebularis. V. surrecta mushrooms have white or greyish silky-hairy caps up to 8 cm in diameter, and white gills that turns pink in maturity. The stipe, also white, is up to 9 cm long, and has a sack-like volva at its base.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Volvariella surrecta has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

eDNA detections11

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPP660664.1 ↗571 bpSpain

ACGT

AAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGAATAGAACAAAGCGACCTCGGCTGATGCTGGCTCCTAGGAGCATGTGCACG …

Volvariella surrecta voucher SFC081108 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Volvariella surrecta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈27 932 191 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Volvariella surrecta0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness91.7% BUSCO

08Occurrence & distribution

Record type1 265 records

Wild obs. + sensor1 089

Museum / vouchered174

Other2

Range

Area of Occupancy AOO2 896 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy33% within 1 km

≤100 m 176≤1 km 152≤10 km 638>10 km 19

985 georeferenced · 104 without coordinates

Open the mapobservation + sensor1 089

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy56% within 1 km

≤100 m 16≤1 km 40≤10 km 43>10 km 1

100 georeferenced · 74 without coordinates

Open the institutions mapphysical evidence174

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 37 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	23
Olocation not on record	16
SLU Artdatabankenlocation not on record	10
WU-MYClocation not on record	9
Copenhagen, DK	8
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	8
GJOlocation not on record	7
Görlitz, DE	7
MeiseBGlocation not on record	7
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	6
Auckland, NZ	5
Göteborg, SE	4
Karlsruhe, DE	4
Helsinki, FI	3
San Sebastián, ES	3
MAlocation not on record	2
Mlocation not on record	2
Philadelphia, US	2
Zürich, CH	2
Trondheim, NO	2
Bronx, US	1
Tilburg, NL	1
Bernard Price Institute for Palaeontological Researchlocation not on record	1
Universidade de Lisboa, Museu Bocagelocation not on record	1
Uppsala, SE	1
University of Oslo, Natural History Museumlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1
Provincia di Livornolocation not on record	1
St. Paul, US	1
nsnflocation not on record	1
Chicago, US	1
CJBGlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
BDBClocation not on record	1
TENN-Flocation not on record	1
Bardejov, SK	1
Adam Mickiewicz University in Poznańlocation not on record	1

37 institutions · 147 of 174 vouchered records shown · 27 without an institution code

09Environmental DNA11 detections

Where the DNA of Volvariella surrecta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found11

Studies independent surveys2

Countries2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 11 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 10.1–17.8

Seasonal swing summer↔winter22.7 °C

Max temp (day)18.9 °C 12.6–21.6

Min temp (night)13.6 °C 7.60–14.4

Precipitation75.7 mm/mo 67.9–93.5

Air humidity60.1 % 59.8–64.7

Moisture balance-36.9 mm/mo

Vapour deficit762 Pa 446–815

Wind speed3.50 m/s

Cloud cover38.5 % 38.4–45.1

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Volvariella surrecta

At a glance

Sources10 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 265 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions17 of 37 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 265 records