Volachlamys hirasei

(Bavay, 1904) · species

image placeholder — illustration coming later

Animalia/Mollusca/Bivalvia/Pectinida/Pectinidae/Volachlamys

At a glance

Occurrence records77

Data sources7

Biological traits2

DNA specimens21

eDNA detections21

Sources7 archives

Databases and archives Volachlamys hirasei's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

OBISOcean Biodiversity Information System19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF · OBIS77 records

Environmental DNA1 datasets · 0 countries21 detections

DNA & barcodingBOLD21 specimens

01Narrative

Volachlamys hirasei is een tweekleppigensoort uit de familie van de Pectinidae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1904 door Bavay.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonebenthic

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Volachlamys hirasei has left across the world's sequence archives.

At a glance

DNA specimens21

BINs1

Marker genes1

eDNA detections21

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P831 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 34 variable positions, in barcode order

52Cvariable

58Cmostly conserved

79Gmostly conserved

136Tmostly conserved

139Amostly conserved

175Tmostly conserved

181Tmostly conserved

211Tmostly conserved

214Cmostly conserved

215Cmostly conserved

229Gmostly conserved

235Tmostly conserved

247Cvariable

250Tmostly conserved

337Cmostly conserved

353Tmostly conserved

370Cmostly conserved

410Tmostly conserved

445Cmostly conserved

479Cmostly conserved

523Amostly conserved

532Gmostly conserved

544Amostly conserved

592Cmostly conserved

604Tmostly conserved

631Tmostly conserved

673Gvariable

676Gmostly conserved

709Tmostly conserved

754Tmostly conserved

784Tmostly conserved

793Cmostly conserved

799Cmostly conserved

802Cmostly conserved

ATACCCTCGTGTTAACACTTTTAGGTTTTGGTTAGTCCCTGCGGCTTTATACATGGTCGTGTTTTCTCCATTTATCGAGAGTGGAAGTGG …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes10

BINs0

Most divergent pair1.9%

AsiaS.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type77 records

Wild obs. + sensor13

Museum / vouchered55

Fossil9

Range

Area of Occupancy AOO124 km²

Depth

0–200 m sunlit1

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 35 m · max 35 m · 1 record with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 1≤1 km 2≤10 km 1>10 km 1

5 georeferenced · 8 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 8>10 km 1

9 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	10
Toyama, JP	6
Philadelphia, US	5
Cambridge, US	3
Nishinomiya Shell Museumlocation not on record	3
Natural History Museum Rotterdamlocation not on record	3
Wakayama Prefectural Museum of Natural Historylocation not on record	2
Sam Noble Oklahoma Museum of Natural Historylocation not on record	2
Gifu prefectural Museumlocation not on record	2
Denver, US	1

10 institutions · 37 of 55 vouchered records shown

09Environmental DNA21 detections

Where the DNA of Volachlamys hirasei was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)