Vitis vinifera
speciesAt a glance
Occurrence records86 068
Data sources18
Biological traits72
DNA specimens41
eDNA detections25
Sources18 archives
Databases and archives Vitis vinifera's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility86 058 records↗
OBISOcean Biodiversity Information System9 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics41 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Tree of SexTree of Sex Consortiumgenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources72 traits
Chemical compositionFooDB · LOTUS · NPASS6 617 compounds
Occurrence & distributionGBIF · OBIS · PBDB86 068 records
Environmental DNA1 datasets · 5 countries25 detections
DNA & barcodingBOLD · NCBI41 specimens
Genome at a glanceCCDB · GoaT · TreeOfSex606 Mbp
Deep timePBDB1 fossils
01Narrative
Vitis vinifera, la vigne cultivée ou simplement la vigne, est une espèce de plantes dicotylédones de la famille des Vitacées, originaire du Proche-Orient mais désormais cultivée dans tous les continents à l'exception de l'Antarctique. Ce sont des arbrisseaux sarmenteux, grimpants s'accrochant à leur supports par des vrilles, dont les tiges peuvent atteindre six mètres de long. Vitis vinifera est cultivée pour ses fruits en grappes, le raisin, qui est consommé frais comme raisin de table, séché comme raisin sec ou fermenté pour produire du vin. C'est l'espèce qui fournit le moût de raisin le plus apprécié, destiné à la fabrication du vin. Principale espèce de vigne cultivée en Europe et dans le monde, elle est à l'origine de très nombreux cépages de cuve ou de table.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYAusTraitsWCVP
Size & morphology28
Fruit length15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 13.8 mm
Fruit length max25 mm
Fruit length min6 mm
Fruit width15 mm
⚠ sources differ — AusTraits: 15 mm · GIFT: 11.43 mm
Fruit width max20 mm
Fruit width min15 mm
Inflorescence length max20 cm
Inflorescence length min10 cm
Leaf length100 mm
⚠ sources differ — AusTraits: 100 mm · GIFT: 125 mm
Leaf length max180 mm
Leaf length min50 mm
Leaf mass415 mg
Leaf size14 941 mm²
Leaf width100 mm
⚠ sources differ — AusTraits: 100 mm · GIFT: 110 mm
Leaf width max180 mm
Leaf width min50 mm
Petiole length3.5 cm
Plant height12.5 m
⚠ sources differ — GIFT: 12.5 m · LEDA: 10 m · TRY: 30 m
Plant height generative6.5 m
Plant height max30 m
Plant height min2 m
Seed length6.13 mm
⚠ sources differ — TRY: 6.13 mm · AusTraits: 4 mm
Seed mass29.19 mg
⚠ sources differ — TRY: 29.19 mg · LEDA: 18 mg · GIFT: 25.5 mg
Seed mass max43 mg
Seed mass min18 mg
Seed volume24 mm³
Seed volume max24 mm³
Seed volume min24 mm³
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourgreen
Flower length max5.5 mm
Flower length min5 mm
Flowering endJun
Flowering startApr
Life formliana
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formLiana
⚠ sources differ — LEDA: Liana · GIFT: phanerophyte
Reproduction asexualabsent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment16
Aquaticterrestrial
Climatetemperate
Climberobligatory
Elevation max2 200 m
Elevation min0 m
Epiphyteterrestrial
Fruit colourblue
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
⚠ sources differ — GIFT: shrub · AusTraits: climber_woody · TRY: L
Habitat GIFTcultivated, sometimes locally escaped
Leaf compoundnesssimple
Leaf formlobed
Leaf shapeorbicular
Mycorrhiza typearbuscular
Woodinesswoody
⚠ sources differ — TRY: woody · AusTraits: woody · LEDA: non-woody · GIFT: woody
Physiology & chemistry7
Leaf dry-matter content (LDMC)174 mg/g
⚠ sources differ — TRY: 174 mg/g · LEDA: 160 mg/g
Leaf n25.23 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)18.95 mm²/mg
⚠ sources differ — TRY: 18.95 mm²/mg · LEDA: 23.68 mm²/mg · GIFT: 24.71 mm²/mg
Wood density400 mg/cm³
Other traits4
Diaspore typefruit
Inflorescencepanicle
Seeds per fruit1-10
Shoot orientationscandent
03Chemical composition6 617 compounds
Compounds documented for Vitis vinifera across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Anthocyanidins159
Oligomeric stibenes126
Aminoacids107
Proanthocyanins95
Cinnamic acids and derivatives92
Documented compounds6 617 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 67,280 mg/100g | FooDB | |
| D-Fructose | 29,680 mg/100g | FooDB | |
| D-Mannose | 27,750 mg/100g | FooDB | |
| Retinol | 27,521 IU | FooDB | |
| Geraniol | 14,520 mg/100g | FooDB | |
| Sucrose | 10,950 mg/100g | FooDB | |
| alpha-Terpineol | 10,800 mg/100g | FooDB |
05DNA & barcoding41 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vitis vinifera has left across the world's sequence archives.
At a glance
DNA specimens41
Marker genes9
GenBank sequences10
eDNA detections25
Countries6
The DNA barcodea real sequence read deposited for this species
TGGGCGAACGACGGGAATTGAACCCGCGCATGGTGGATTCACAATCCACTGCCTTGATCCACTTGGCTACATCCGCCCCTCTACTATTCA …
Vitis vinifera subsp. sylvestris Lambrusque de semis Tekkale Kilisi 13-5 chloroplast DNA, complete genome
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★COI-5P★matK★rbcL10★rbcLa★ITS★ITS2atp6COIICOXIII
animal barcodeplant barcodefungal barcodemitochondrial
06Genome at a glanceCCDB · GoaT · TreeOfSex · NCBI
The complete instruction manual Vitis vinifera carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size606 360 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Vitis vinifera0.61 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 38 n = 19
Ploidydiploid inferred
Chromosome records38–762n range38median38mode110records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 38101×GoaT · Tree of Sex Database · GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl +9
GoaT · Tree of Sex Database — ↗
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Murín A., 1964a: Karyologisches Studium bei Kulturabarten der Weinrebe (Vitis vinifera L.). - Biologia (Bratislava) 19/1: 16-20.
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · mediterranean
CCDB · ipcn-api-dl — Magulaev, A. J. 1979a. The chromosome numbers of flowering plants in the Northern Caucasus. Part 3. Flora of the North Caucasus and questions of its history,. 3: 101–106.
CCDB · ipcn-api-dl — Pogan, E., A. Jankun, J. Maslecka & H. Wcisslo. 1986. Further studies in chromosome numbers of Polish angiosperms. Part XIX. Acta Biol. Cracov., Ser. Bot. 28: 65–85.
CCDB · ipcn-api-dl — Patil, V. P. & A. S. Jadhav. 1985. Karyomorphology of three varieties of Vitis vinifera. Cytologia 50: 83–88.
CCDB · ipcn-api-dl — Yamashita, H., S. Horiuchi & T. Taira. 1993. Development of seeds and the growth of triploid seedlings obtained from reciprocal crosses between diploid and tetraploid grapes. J. Jap. Soc. Hort. Sci. 62: 249–255.
CCDB · ipcn-api-dl — Chen, R. y. 1993. (editor), Chromosome Atlas of Chinese Fruit Trees and Their Close Wild Relatives. Chromosome Atlas Chin. Princ. Econ. Pl. 1.
CCDB · ipcn-api-dl — Ivanova. 2005. Mediterranean chromosome number reports 15 (1445--1456). Fl. Medit. 15: 719–728.
CCDB · book-ipcn67-71 — ELENA, P. 1967. Cercetariacariologice la un11 representanti ai familiei Vitaceae. Acta Bot. Hort. Bucurestensis. 1966. 27-36.
CCDB · book-ipcn67-71 — RAJ, A.S., & L. SEETHAIAH. 1969. Karyotype analysis and meiotic studies in three varieties of grape (Vitis vinifera L.). Cytologia 34: 475-483.
CCDB · book-ipcn67-71 — HAZRA, R., & A. SHARMA. 1970. Chromosomes of some Indian Vitaceae. Folia Biol. (Cracow). 18: 123-136.
CCDB · book-ipcn73-74 — SUDHARSAM RAJ, A., & L. SEETHAIAH. 1973. Cytological studies in grape (Vitis vinifera L.). Cytologia 38: 549-557.
CCDB · Cave1956supp — Patel & Olmo 1955
CCDB · Cave1958 — Shetty 1958
CCDB · CromoCat 2015 — Alley, C. J. (1957). Cytogenetics of Vitis. II. Chromosome behavior and the fertility of some autotetraploid derivatives of Vitis vinifera L. J. Heredity 48: 195-202.
CCDB · CromoCat 2015 — Baranov, P. & Rajkova, H. (1930). The male flower of grapes. Bull. Appl. Bot., Genet. & Plant Breeding 24: 283-298.
CCDB · CromoCat 2015 — Branas, M. C. R. (1932). Sur la caryologie des Ampélidées. Compt. Rend. Acad. Sci. Paris 194: 121-123.
CCDB · CromoCat 2015 — Christov, M. (1929). Cytological studies on some species of Vitaceae. Bull. Soc. Bot. Bulg. 3: 279-302.
CCDB · CromoCat 2015 — Elena, P. (1967). Cercetariacariologice la unii representanti ai familiei Vitaceae. Acta Bot. Horti Bucures 1966: 27-36.
CCDB · CromoCat 2015 — Ghimpu, V. (1929c). Recherches chromosomiques sur les luzernes, vignes, chênes et orges. XIV Congr. Int. Agr. Bucarest, Actes 4: 557-563.
CCDB · CromoCat 2015 — Ghimpu, V. (1930). Recherches cytologiques sur les genres: Hordeum, Acacia, Medicago, Vitis et Quercus. Arch. Anat. Microsc. 26: 135-249.
CCDB · CromoCat 2015 — Ghimpu, V. (1941). Sur les recherches caryologiques des plantes. Compt. Rend. Acad. Sci. Roumania 5: 88-95.
CCDB · CromoCat 2015 — Hazra, R. & Sharma, A. (1970). Chromosomes of some Indian Vitaceae. Folia Biol. (Cracow.) 18: 123-136.
CCDB · CromoCat 2015 — Hirayanagi, H. (1929). Chromosome arrangement. III. The pollen mother cells of the vine. Mem. Kyoto Univ. 4: 273-281.
CCDB · CromoCat 2015 — Husfeld, B. (1932). Uber die Züchtung Plasmopara-widerstandsfähiger Reben. Gartenbauwiss. 7: 15-92.
CCDB · CromoCat 2015 — Ivanova-Paroyskaya, M. (1930). Steril'nost' pyl'zy sredne-aziatshikh zenskikh rostov vino-grada. Bull. Appl. Bot., Genet. & Plant Breeding 24: 93-157.
CCDB · CromoCat 2015 — Kobel, F. (1929a). Die cytologischen und genetischen voraussetzungen für die immunitätszüchtung der rebe. Züchter 1: 197-202.
CCDB · CromoCat 2015 — Kobel, F. (1929b). Zytologische untersuchungen als grundlage für die immunitätszüchtung der rebe. Landw. Jahrb. Schweiz 43: 231-272.
CCDB · CromoCat 2015 — Krishnaswamy, N., Raman, V. S., Shetty,B. V. & Chandrasekharan, P. (1954). Chromosome numbers of some Indian economic plants. Curr. Sci. 23: 64-65.
CCDB · CromoCat 2015 — Lattin, G., de (1940). Spontane und induzierte polyploidie bei reben. Züchter 12: 225-231.
CCDB · CromoCat 2015 — Lattin, G., de (1951). Hyperploidie in der gattung Vitis. Naturwissenschaften 38. 531-532.
CCDB · CromoCat 2015 — Nebel, B. R. (1929). Zur Zytologie von Malus und Vitis. Gartenbauwiss. 1: 549-592.
CCDB · CromoCat 2015 — Nebel, B. R. (1930). Chromosome counts in Vitis and Pyrus. Amer. Naturalist 63: 188-189.
CCDB · CromoCat 2015 — Negrul, A. M. (1930). Chromosomenzahl und charakter der reduktionsteilung bei den artbastarden der weinrebe (Vitis). Züchter 2: 33-43.
CCDB · CromoCat 2015 — Olmo, H. P. (1937). Chromosome numbers in the European grape (Vitis vinifera). Cytologia Fujii Jub.: 606
CCDB · CromoCat 2015 — Patel, G. I. & H. P. Olmo. (1955). Cytogenetics of Vitis. I. The hybrid V. vinifera x V. rotundifolia. Amer. J. Bot. 42: 141-159.
CCDB · CromoCat 2015 — Patel, G. I. & H. P. Olmo. (1957). Interspecific triploid hybrid in grape. Caryologia 9: 340-352.
+7 more references
2n 579×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Alley, C. J. (1957). Cytogenetics of Vitis. II. Chromosome behavior and the fertility of some autotetraploid derivatives of Vitis vinifera L. J. Heredity 48: 195-202.
CCDB · CromoCat 2015 — Branas, M. C. R. (1932). Sur la caryologie des Ampélidées. Compt. Rend. Acad. Sci. Paris 194: 121-123.
CCDB · CromoCat 2015 — Lattin, G., de (1940). Spontane und induzierte polyploidie bei reben. Züchter 12: 225-231.
CCDB · CromoCat 2015 — Lattin, G., de (1951). Hyperploidie in der gattung Vitis. Naturwissenschaften 38. 531-532.
CCDB · CromoCat 2015 — Nebel, B. R. (1929). Zur Zytologie von Malus und Vitis. Gartenbauwiss. 1: 549-592.
CCDB · CromoCat 2015 — Nebel, B. R. (1930). Chromosome counts in Vitis and Pyrus. Amer. Naturalist 63: 188-189.
CCDB · CromoCat 2015 — Olmo, H. P. (1937). Chromosome numbers in the European grape (Vitis vinifera). Cytologia Fujii Jub.: 606
CCDB · CromoCat 2015 — Scherz, W. (1940). Uber somatische Genommutaten der Vitis vinifera Varietät Moselriesling. Züchter 12: 212-225.
CCDB · CromoCat 2015 — Stout, A. B. (1939). Progress in breeding for seedless grapes. Proc. Amer. Soc. Hort. Sci. 37: 627-629.
2n 769×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Alley, C. J. (1957). Cytogenetics of Vitis. II. Chromosome behavior and the fertility of some autotetraploid derivatives of Vitis vinifera L. J. Heredity 48: 195-202.
CCDB · CromoCat 2015 — Branas, M. C. R. (1932). Sur la caryologie des Ampélidées. Compt. Rend. Acad. Sci. Paris 194: 121-123.
CCDB · CromoCat 2015 — Lattin, G., de (1940). Spontane und induzierte polyploidie bei reben. Züchter 12: 225-231.
CCDB · CromoCat 2015 — Lattin, G., de (1951). Hyperploidie in der gattung Vitis. Naturwissenschaften 38. 531-532.
CCDB · CromoCat 2015 — Nebel, B. R. (1929). Zur Zytologie von Malus und Vitis. Gartenbauwiss. 1: 549-592.
CCDB · CromoCat 2015 — Nebel, B. R. (1930). Chromosome counts in Vitis and Pyrus. Amer. Naturalist 63: 188-189.
CCDB · CromoCat 2015 — Olmo, H. P. (1937). Chromosome numbers in the European grape (Vitis vinifera). Cytologia Fujii Jub.: 606
CCDB · CromoCat 2015 — Scherz, W. (1940). Uber somatische Genommutaten der Vitis vinifera Varietät Moselriesling. Züchter 12: 212-225.
CCDB · CromoCat 2015 — Stout, A. B. (1939). Progress in breeding for seedless grapes. Proc. Amer. Soc. Hort. Sci. 37: 627-629.
n 195×CCDB · book-ipcn67-71 · CCDB · book-ipcn75-78 · CCDB · book-ipcn73-74 +2
CCDB · book-ipcn67-71 — Q30 TAKUSAGAWA, H. 1952. Chromosome numbers of the Vitaceae. Jap. J. Genet. 27: 22-2Q.
CCDB · book-ipcn75-78 — Bouquet 1978
CCDB · book-ipcn73-74 — SUDHARSAM RAJ, A., & L. SEETHAIAH. 1973. Cytological studies in grape (Vitis vinifera L.). Cytologia 38: 549-557.
CCDB · Cave1956supp — Patel & Olmo 1955
CCDB · Cave1958 — Shetty 1958
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelComplete Genome
Completeness97.3% BUSCO
07Deep time2.58–0.77 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range2.58–0.77 Ma Pleistocene
Dated fossil finds1
StatusNot recorded since 0.77 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Vitis vinifera. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type86 068 records
Wild obs. + sensor79 963
Museum / vouchered3 750
Cultivated / captive684
Fossil2
Other1 669
Origin
Native1 355
Introduced672
Range
Area of Occupancy AOO96 364 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy83% within 1 km
≤100 m 57 952≤1 km 1 949≤10 km 12 041>10 km 299
72 241 georeferenced · 7 722 without coordinates
Open the mapobservation + sensor79 963
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy70% within 1 km
≤100 m 279≤1 km 635≤10 km 347>10 km 48
1 309 georeferenced · 2 441 without coordinates
Open the institutions mapphysical evidence3 750
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy1% within 1 km
≤100 m 3≤1 km 4≤10 km 346>10 km 253
606 georeferenced · 78 without coordinates
Open the mapnot free-living684
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions121 of 218 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| ESP080location not on record | 623 |
| CICYTEXlocation not on record | 404 |
| BIO-UNIPIlocation not on record | 298 |
| Paris, FR | 177 |
| BClocation not on record | 166 |
| ESP074location not on record | 155 |
| Davis, US | 155 |
| Moscow State Universitylocation not on record | 92 |
| Beijing, CN | 66 |
| ROM017location not on record | 58 |
| SLU Artdatabankenlocation not on record | 56 |
| MKD001location not on record | 52 |
| AZE015location not on record | 50 |
| Saint Louis, US | 46 |
| Karlsruhe, DE | 38 |
| Görlitz, DE | 38 |
| MAlocation not on record | 35 |
| BDBClocation not on record | 35 |
| Helsinki, FI | 34 |
| LDlocation not on record | 33 |
| HRV041location not on record | 33 |
| ROM022location not on record | 33 |
| Olocation not on record | 32 |
| Mlocation not on record | 29 |
| Auckland, NZ | 23 |
| Henry Brockhouse Collectionlocation not on record | 22 |
| Barcelona, ES | 22 |
| Adelaide, AU | 21 |
| San Diego, US | 21 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 20 |
| Bern, CH | 19 |
| Vancouver, CA | 19 |
| València, ES | 18 |
| Philadelphia, US | 17 |
| WTUlocation not on record | 17 |
| Tartu, EE | 16 |
| Vitoria, ES | 15 |
| Alicante, ES | 14 |
| Santa Barbara, US | 13 |
| Claremont, US | 13 |
| MeiseBGlocation not on record | 13 |
| UChlocation not on record | 13 |
| Oskarshamn, SE | 13 |
| Canberra, AU | 12 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Berlin, DE | 12 |
| Zhengzhou, CN | 11 |
| Christchurch, NZ | 11 |
| Hobart, AU | 11 |
| Turlock, US | 11 |
| Pullman, US | 10 |
| Wlocation not on record | 10 |
| Turku, FI | 10 |
| Yangling, CN | 10 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 9 |
| KMNlocation not on record | 9 |
| Puerto Ayora, EC | 9 |
| Museo Entomologico de Leonlocation not on record | 9 |
| Stockholm, SE | 9 |
| Provincia di Livornolocation not on record | 9 |
| Canadian Department of Agriculturelocation not on record | 8 |
| Kew, GB | 8 |
| Riverside, US | 8 |
| Wellington, NZ | 8 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 8 |
| BFLlocation not on record | 8 |
| Adam Mickiewicz University in Poznańlocation not on record | 7 |
| San Luis Obispo, US | 7 |
| Entomological Society of Latvialocation not on record | 7 |
| Chengdu, CN | 7 |
| Kensington, AU | 7 |
| Salzburg, AT | 7 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 6 |
| Bronx, US | 6 |
| Mount Annan, AU | 6 |
| Phoenix, US | 6 |
| Universidad de Caldas (UCaldas)location not on record | 6 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Oulu, FI | 5 |
| Salamanca, ES | 5 |
| College of the Atlantic, Museumlocation not on record | 5 |
| DBF-NHMDlocation not on record | 5 |
| Uniwersytet Wrocławskilocation not on record | 5 |
| PUC-RSlocation not on record | 5 |
| Guangzhou, CN | 5 |
| Bourges, FR | 4 |
| Rotorua, NZ | 4 |
| UFOPlocation not on record | 4 |
| Nanjing, CN | 4 |
| University of Stellenboschlocation not on record | 4 |
| OLAlocation not on record | 4 |
| Uniwersytet Opolskilocation not on record | 4 |
| CJBGlocation not on record | 4 |
| Millersville, US | 4 |
| Chicago, US | 4 |
| Kunming, CN | 4 |
| Córdoba, ES | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Urumqi, CN | 4 |
| Granada, ES | 3 |
| AUAlocation not on record | 3 |
| Arizona State University Biocollectionslocation not on record | 3 |
| Moscow, US | 3 |
| ASUlocation not on record | 3 |
| National Biodiversity Institute, Costa Ricalocation not on record | 3 |
| University of Guelph, OAC Herbariumlocation not on record | 3 |
| Guilin, CN | 3 |
| Chengdu, CN | 3 |
| Monastir, TN | 3 |
| Central China Normal Universitylocation not on record | 3 |
| South Kensington, GB | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Allentown, US | 3 |
| Mexico City, MX | 3 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 2 |
| Corvallis, US | 2 |
| Universidad de Antioquia (UdeA)location not on record | 2 |
| GMBAlocation not on record | 2 |
| Angwin, US | 2 |
| Guiyang, CN | 2 |
| WNNUlocation not on record | 2 |
| Pamplona, ES | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Jaén, ES | 2 |
| Dehra Dun, IN | 2 |
| UIBlocation not on record | 2 |
| Logan, US | 2 |
| Badajoz, ES | 2 |
| Xining, CN | 2 |
| Wuhan, CN | 2 |
| Brussel, BE | 2 |
| Pamplona, ES | 2 |
| Riobamba, EC | 2 |
| BRNUlocation not on record | 2 |
| Blumenau, BR | 2 |
| Porrentruy, CH | 2 |
| UoB-IBlocation not on record | 1 |
| Viña del Mar, CL | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Beijing, CN | 1 |
| Porvoo, FI | 1 |
| Alexandria Universitylocation not on record | 1 |
| Portland, US | 1 |
| Université de Strasbourglocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Córdoba, AR | 1 |
| Los Angeles, US | 1 |
| Juriquilla, MX | 1 |
| Umeå Universitylocation not on record | 1 |
| Salvador, BR | 1 |
| Durham, US | 1 |
| Long Beach, US | 1 |
| REALlocation not on record | 1 |
| Santa Cruz, US | 1 |
| Miami, US | 1 |
| Jataí / Setor Industrial, BR | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Fort Worth, US | 1 |
| Universidade Federale do Rio Grande do Sullocation not on record | 1 |
| Maringá, BR | 1 |
| Chongqing Museumlocation not on record | 1 |
| San Diego Natural History Museumlocation not on record | 1 |
| Puebla, MX | 1 |
| Musée des Confluenceslocation not on record | 1 |
| University of Nevadalocation not on record | 1 |
| La Paz, BO | 1 |
| Mexico City, MX | 1 |
| Université Lavallocation not on record | 1 |
| 黔东南州民族医药研究所标本室location not on record | 1 |
| Jiangxi College of Educationlocation not on record | 1 |
| Laboratorio de Ictiologialocation not on record | 1 |
| CASlocation not on record | 1 |
| Honolulu, US | 1 |
| JBSlocation not on record | 1 |
| SDFlocation not on record | 1 |
| Bratislava, SK | 1 |
| Lausanne, CH | 1 |
| Nagasaki University - Fisherieslocation not on record | 1 |
| UTFPR-DVlocation not on record | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Muzaffarabad, PK | 1 |
| GZUlocation not on record | 1 |
| Gump Stationlocation not on record | 1 |
| Frankfurt am Main | 1 |
| Durban, ZA | 1 |
| Uberlândia, BR | 1 |
| Nijmegen, NL | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Jiujiang Forestry Institutelocation not on record | 1 |
| Universidad de Nariño (UdeNar)location not on record | 1 |
| Guangzhou, CN | 1 |
| Firenze, IT | 1 |
| Zhuzhou, CN | 1 |
| UNESClocation not on record | 1 |
| Provo, US | 1 |
| EL PASO, US | 1 |
| Xiamen, CN | 1 |
| San Bernardino, US | 1 |
| Victoria, CA | 1 |
| Irvine, US | 1 |
| US | 1 |
| Nishihara, JP | 1 |
| Henderson, US | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| GJOlocation not on record | 1 |
| NMBU:MINAlocation not on record | 1 |
| Oswego, US | 1 |
| Zürich, CH | 1 |
| Chapingo, MX | 1 |
| ESALQlocation not on record | 1 |
| Universidad Nacional de La Pampalocation not on record | 1 |
| Brisbane, AU | 1 |
| MHNAIXlocation not on record | 1 |
| Sion, CH | 1 |
| Dresden, DE | 1 |
| USP-IBlocation not on record | 1 |
| Xian, CN | 1 |
218 institutions · 3 629 of 3 750 vouchered records shown · 102 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Vitis vinifera was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map5 countries0
River shoreburned (2002) Quercus agrifolia var. oxyaden…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.4 °C 11.6–20.4
Seasonal swing summer↔winter16.8 °C
Max temp (day)18.5 °C 14.2–25.8
Min temp (night)11.1 °C 10.0–15.1
Precipitation55.2 mm/mo 2.80–86.1
Air humidity59.5 % 54.7–61.1
Moisture balance-51.6 mm/mo -172–30.1
Vapour deficit700 Pa 552–1,116
Wind speed3.50 m/s 2.80–4.40
Cloud cover42.5 % 26.2–53.3
CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.