Vibrissea decolorans

(Saut.) A.Sánchez & Korf · species

image placeholder — illustration coming later

Fungi/Ascomycota/Leotiomycetes/Helotiales/Vibrisseaceae/Vibrissea

At a glance

Occurrence records186

Data sources6

Biological traits0

DNA specimens1

eDNA detections1

Sources6 archives

Databases and archives Vibrissea decolorans's data was compiled from.

GBIFGlobal Biodiversity Information Facility186 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF186 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vibrissea decolorans has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOP651087.1 ↗491 bpUSA · 2019

ACGT

AAGGATCATTACCAGTGAAGTGCCCGCGCCCTCGTGGCCGGGTGCCCACCCACCCGTGTCTACATACTCTTGTTGCTTTGGCAGGCCGTG …

Vibrissea decolorans isolate iNat91973351 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type186 records

Wild obs. + sensor100

Museum / vouchered86

Range

Area of Occupancy AOO620 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy39% within 1 km

≤100 m 24≤1 km 11≤10 km 55

90 georeferenced · 10 without coordinates

Open the mapobservation + sensor100

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤100 m 5≤1 km 16≤10 km 20>10 km 5

46 georeferenced · 40 without coordinates

Open the institutions mapphysical evidence86

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 25 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Karlsruhe, DE	11
Catholic University of Pekinglocation not on record	11
TROMlocation not on record	7
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	6
Uppsala, SE	6
Copenhagen, DK	5
Olocation not on record	4
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	3
Ann Arbor, US	2
SLU Artdatabankenlocation not on record	2
Pullman, US	2
Stockholm, SE	2
WU-MYClocation not on record	2
LDlocation not on record	2
nsnflocation not on record	2
Oregon State University, Herbariumlocation not on record	1
San Sebastián, ES	1
Gijón, ES	1
	1
Tilburg, NL	1
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Fort Hayslocation not on record	1
Tartu, EE	1
Kew, GB	1
Universidade de Lisboa, Museu Bocagelocation not on record	1

25 institutions · 77 of 86 vouchered records shown · 9 without an institution code

09Environmental DNA1 detections

Where the DNA of Vibrissea decolorans was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.1 °C 11.1–11.1

Seasonal swing summer↔winter17.1 °C

Max temp (day)17.2 °C

Min temp (night)5.20 °C

Precipitation129 mm/mo

Air humidity61.5 %

Moisture balance12.1 mm/mo

Vapour deficit510 Pa

Wind speed1.00 m/s

Cloud cover42.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)