Verticillium nonalfalfae

Inderb., H.W.Platt, R.M.Bostock, R.M.Davis & Subbarao · species

image placeholder — illustration coming later

Fungi/Ascomycota/Sordariomycetes/Glomerellales/Plectosphaerellaceae/Verticillium

At a glance

Occurrence records38

Data sources8

Biological traits0

DNA specimens12

eDNA detections13

Sources8 archives

Databases and archives Verticillium nonalfalfae's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility38 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics12 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF38 records

Environmental DNA3 datasets · 4 countries13 detections

DNA & barcodingBOLD · NCBI12 specimens

Genome at a glanceGoaT · NCBI≈34 Mbp

01Narrative

Verticillium nonalfalfae is a soilborne fungus in the order Hypocreales. It causes verticillium wilt in some plant species, particularly Ailanthus altissima. The fungus produces a resting mycelium characterized by brown-pigmented hyphae. It is most closely related to V. albo-atrum and V. alfalfae. Common hop plants showing foliar symptoms of Verticillium wilt caused by Verticillium albo-atrum on a field at Oregon, USA. Common hop plants showing foliar symptoms of Verticillium wilt caused by Verticillium albo-atrum on a field at Oregon, USA.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding12 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Verticillium nonalfalfae has left across the world's sequence archives.

At a glance

DNA specimens12

Marker genes2

GenBank sequences10

eDNA detections13

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPQ579585.1 ↗255 bpIndia · 2024

ACGT

CTGGGAGGCATGCCTGTCCGAGCGTCGTTTCAACCCTCGAGCCCCAGTGGCCCGGTGTTGGGGATCTACGTCTGTAGGCCCTTAAAAGCA …

Verticillium nonalfalfae 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★ITS10

animal barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Verticillium nonalfalfae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈33 577 733 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Verticillium nonalfalfae0.03 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelComplete Genome

Completeness78.2% BUSCO

08Occurrence & distribution

Record type38 records

Wild obs. + sensor1

Museum / vouchered14

Cultivated / captive23

Range

Area of Occupancy AOO40 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 14 records without

Open the institutions mapphysical evidence14

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

>10 km 3

3 georeferenced · 20 without coordinates

Open the mapnot free-living23

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Verticillium nonalfalfae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys3

Countries4

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map4 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 9.60–13.5

Seasonal swing summer↔winter20.5 °C

Max temp (day)14.3 °C 11.3–16.9

Min temp (night)5.50 °C 5.00–11.2

Precipitation100 mm/mo 93.6–170

Air humidity62.0 % 61.8–63.7

Moisture balance22.7 mm/mo

Vapour deficit543 Pa 461–689

Wind speed2.90 m/s

Cloud cover44.9 % 42.3–50.0

CHELSA 1981–2010, ~9 km grid, at location & month of 9 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)