Vertebrata lanosa

(L.) T.A.Chr. · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Rhodomelaceae/Vertebrata

At a glance

Occurrence records10 327

Data sources11

Biological traits2

DNA specimens31

eDNA detections65

Sources11 archives

Databases and archives Vertebrata lanosa's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 358 records↗

OBISOcean Biodiversity Information System4 969 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI65 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics31 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Chemical compositionLOTUS · NPASS43 compounds

Occurrence & distributionGBIF · OBIS10 327 records

Environmental DNA2 datasets · 5 countries65 detections

DNA & barcodingBOLD · NCBI31 specimens

01Narrative

Vertebrata lanosa on Ascophyllum nodosum 1 tufts growing on Ascophyllum nodosum; 2 portion of a frond; 3 ceramidia = cystocarps; 4 branchlet with embedded tetraspores; 5 tetraspore; 6 apices with antheridia; 7 antheridium; 8 portion of a frond, partly cut longitudinally; 9 transverse section of a frond Polysiphonia lanosa (Vertebrata lanosa;Bunker, F.StP.D., Maggs, C.A., Brodie, J.A. and Bunker, A.R. 2017 Seaweeds of Britain and Ireland. Second Edition. Wild Nature Press, Plymouth Press, UK. Polysiphonia fastigiata) is a common species of the red algae (Rhodophyta) often to be found growing on Ascophyllum nodosum.Maggs, C.A. and Hommersand, M.H. 1993, Seaweeds of the British Isles Volume 1 Rhodophyta Part 3A Ceramiales. The Natural History Museum, London

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zoneepiphytic

03Chemical composition43 compounds

Compounds documented for Vertebrata lanosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Simple coumarins7

Monomeric stilbenes5

Simple phenolic acids3

Cyclitols3

Disaccharides $ Polysaccharides2

Documented compounds43 total

Tissue Source Quantified only

Compound	Amount	Source
(2S,3R,4S,5R,6R)-2-(((2R,3R,4S,5R,6R)-6-((2R)-2,3-Dihydroxypropoxy)-3,4,5-Trihydroxyoxan-2-Yl)Methoxy)-6-(Hydroxymethyl)Oxane-3,4,5-Triol	present	LOTUS
(3S,3aR,6S,6aS)-6-[(2,3-dibromo-4,5-dihydroxyphenyl)methyl]-3,6,6a-trihydroxy-3,3a-dihydro-2H-furo[3,2-b]furan-5-one	present	LOTUS
2,3-Dibromo-4,5-Dihydroxybenzaldehyde	present	LOTUS
2,3-Dibromo-4-hydroxy-5-methoxybenzaldehyde	present	LOTUS
2,5-Dibromo-3,4-Dihydroxybenzaldehyde	present	LOTUS
2-[[6-(2,3-Dihydroxypropoxy)-3,4,5-trihydroxyoxan-2-yl]methoxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
3,4-Dibromo-5-(ethoxymethyl)benzene-1,2-diol	present	LOTUS
3,4-Dibromo-5-(hydroxymethyl)-1,2-benzenediol	present	LOTUS
3,4-Dibromo-5-(methoxymethyl)benzene-1,2-diol	present	LOTUS
3,4-Dibromo-5-(propoxymethyl)benzene-1,2-diol	present	LOTUS

05DNA & barcoding31 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vertebrata lanosa has left across the world's sequence archives.

At a glance

DNA specimens31

BINs1

Marker genes4

GenBank sequences10

eDNA detections65

The DNA barcodea real sequence read deposited for this species

rbcLLR738856.1 ↗635 bpFrance · 2018

ACGT

GATGTACTAGCATTATTTAGGGTTTCACCTCAACCAGGTGTAGATCCGGTAGAAGCGTCTGCTGCAGTTGCTGGGGAATCTTCTACTGCT …

Vertebrata lanosa plastid partial ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit, partial gene for rbcL, strain ROS 22

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Eutrichosiphonia confusasame family10.8%Savoiea arcticasame family10.8%Savoiea hamatasame family11.3%Polysiphonia paniculatasame family11.3%Ctenosiphonia hypnoidessame family11.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL1028S28S-D2

animal barcodeplant barcodemarker

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_032003 ↗ · 23 protein · 19 tRNA · 2 rRNA

nad4Lrps3rpl16cox1cox2cox3atp4cobnad6sdhBsdhCatp9rps11nad3nad1nad2sdhDnad4nad5atp8atp6tatCrps12rnlrns

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

08Occurrence & distribution

Record type10 327 records

Wild obs. + sensor4 373

Museum / vouchered4 921

Other1 033

Range

Area of Occupancy AOO9 896 km²

Depth

0–200 m sunlit728

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 3 m · max 14.5 m · 728 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 3 227≤1 km 236≤10 km 220>10 km 11

3 694 georeferenced · 679 without coordinates

Open the mapobservation + sensor4 373

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 98≤1 km 194≤10 km 65>10 km 38

395 georeferenced · 4 526 without coordinates

Open the institutions mapphysical evidence4 921

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 24 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Institut Francais pour l'Etude de la Merlocation not on record	155
Clocation not on record	141
486location not on record	98
DASSHlocation not on record	81
South Kensington, GB	73
Ann Arbor, US	61
PNHSlocation not on record	57
Durham, US	18
Burlington, US	17
LDlocation not on record	17
Durham, US	16
TROMlocation not on record	16
KMNlocation not on record	13
Trondheim, NO	12
Bronx, US	5
University of Stellenboschlocation not on record	4
Chapel Hill, US	3
MeiseBGlocation not on record	2
Champaign, US	2
Citadel Hill, GB	2
Natural History Museum Rotterdamlocation not on record	2
Bourges, FR	2
Porvoo, FI	1
San Diego, US	1

24 institutions · 799 of 4 921 vouchered records shown · 819 without an institution code

09Environmental DNA65 detections

Where the DNA of Vertebrata lanosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found65

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 65 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.60 °C -0.6–16.5

Seasonal swing summer↔winter21.9 °C

Max temp (day)11.2 °C 2.00–18.6

Min temp (night)6.10 °C -2.90–14.9

Precipitation135 mm/mo 99.2–152

Air humidity62.2 % 60.5–66.4

Moisture balance45.9 mm/mo -14.2–92.2

Vapour deficit405 Pa 265–585

Wind speed5.40 m/s 2.50–7.30

Cloud cover49.6 % 47.1–53.1

CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Vertebrata lanosa

At a glance

Sources11 archives

Habitat & environment2

Compound class profile5 classes

Documented compounds43 total

At a glance

Record type10 327 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 24 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type10 327 records