Vertebrata fruticulosa

(Wulfen) Kuntze, 1891 · species

image placeholder — illustration coming later

Plantae/Rhodophyta/Florideophyceae/Ceramiales/Rhodomelaceae/Vertebrata

At a glance

Occurrence records682

Data sources6

Biological traits0

DNA specimens1

eDNA detections6

Sources6 archives

Databases and archives Vertebrata fruticulosa's data was compiled from.

GBIFGlobal Biodiversity Information Facility205 records↗

OBISOcean Biodiversity Information System477 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS682 records

Environmental DNA2 datasets · 2 countries6 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vertebrata fruticulosa has left across the world's sequence archives.

At a glance

DNA specimens1

BINs1

Marker genes2

GenBank sequences5

eDNA detections6

The DNA barcodea real sequence read deposited for this species

rbcLMH388576.1 ↗554 bpFrance · 1993

ACGT

AAAGGTGGCTTAGATTTCCTTAAAGATGATGAAAATATTAACTCTCAACCTTTTATGCGTTGGAAAGAAAGATTTTTATATTCTATGGAA …

Vertebrata fruticulosa voucher UA0268 ribulose-1,5-biphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P★rbcL5

animal barcodeplant barcode

08Occurrence & distribution

Record type682 records

Wild obs. + sensor163

Museum / vouchered131

Other388

Origin

Native35

Range

Area of Occupancy AOO720 km²

Depth

0–200 m sunlit61

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 1.5 m · max 38.5 m · 61 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 62≤1 km 17≤10 km 9

88 georeferenced · 75 without coordinates

Open the mapobservation + sensor163

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 32≤1 km 2

34 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence131

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UAclocation not on record	21
DASSHlocation not on record	15
PNHSlocation not on record	11
MeiseBGlocation not on record	4
Bourges, FR	3
BDBClocation not on record	1
LDlocation not on record	1

7 institutions · 56 of 131 vouchered records shown · 3 without an institution code

09Environmental DNA6 detections

Where the DNA of Vertebrata fruticulosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys2

Countries2

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map2 countries0

Marina; semi-industrial; 9.2 - Subtidal Rock…

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.0 °C 9.40–16.4

Seasonal swing summer↔winter8.60 °C

Max temp (day)17.5 °C 11.3–17.9

Min temp (night)9.10 °C 7.20–15.1

Precipitation82.5 mm/mo 53.9–92.1

Air humidity64.4 % 61.5–66.5

Moisture balance-26.7 mm/mo -76.1–9.00

Vapour deficit620 Pa 434–629

Wind speed5.30 m/s 4.50–6.30

Cloud cover41.9 % 38.7–49.6

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)