Verrucaria funckii

(Spreng.) Zahlbr. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Eurotiomycetes/Verrucariales/Verrucariaceae/Verrucaria

At a glance

Occurrence records413

Data sources7

Biological traits1

DNA specimens7

eDNA detections7

Sources7 archives

Databases and archives Verrucaria funckii's data was compiled from.

GBIFGlobal Biodiversity Information Facility413 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements1 literature sources1 traits

Occurrence & distributionGBIF413 records

Environmental DNA1 datasets · 2 countries7 detections

DNA & barcodingBOLD · NCBI7 specimens

02Traits & measurements

SourcesTRY

Habitat & environment1

Growth formlichen

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Verrucaria funckii has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes1

GenBank sequences10

eDNA detections7

Countries5

The DNA barcodea real sequence read deposited for this species

ITSKM243238.1 ↗487 bpSlovakia · 2009

ACGT

GATTAGGTCCTCTGGGCCCCATCTCCAACCCTTGGTCTATTCTACCATGATTGCTTTGGCGGGCCCGTCTTCAACCGGACCGCCGGGGAT …

Verrucaria funckii voucher H.Thues W1232 (BM000733929) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

08Occurrence & distribution

Record type413 records

Wild obs. + sensor272

Museum / vouchered136

Other5

Range

Area of Occupancy AOO1 176 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 52≤1 km 32≤10 km 176>10 km 7

267 georeferenced · 5 without coordinates

Open the mapobservation + sensor272

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy48% within 1 km

≤100 m 8≤1 km 7≤10 km 15>10 km 1

31 georeferenced · 105 without coordinates

Open the institutions mapphysical evidence136

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 32 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
South Kensington, GB	22
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	17
BDBClocation not on record	9
Uppsala, SE	6
ASUlocation not on record	5
Olocation not on record	5
GZUlocation not on record	4
University of Gdansklocation not on record	4
Madison, US	4
Tempe, US	4
Helsinki, FI	4
	4
M-Lichenslocation not on record	2
Museo Entomologico de Leonlocation not on record	2
Berlin, DE	2
St. Paul, US	2
Staatsarchiv Urilocation not on record	2
Salzburg, AT	2
Canberra, AU	2
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	2
Boise, US	1
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	1
TSBlocation not on record	1
Bergen, NO	1
Durham, US	1
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	1
Göteborg, SE	1
BG-NMNHSlocation not on record	1
Edmonton, CA	1
MeiseBGlocation not on record	1
PRClocation not on record	1
LDlocation not on record	1

32 institutions · 116 of 136 vouchered records shown · 19 without an institution code

09Environmental DNA7 detections

Where the DNA of Verrucaria funckii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.30 °C 8.30–8.30

Seasonal swing summer↔winter18.6 °C

Max temp (day)11.9 °C

Min temp (night)4.50 °C 4.40–4.60

Precipitation57.8 mm/mo 57.6–58.0

Air humidity63.1 % 62.5–63.8

Moisture balance-6.80 mm/mo -9.00–-4.60

Vapour deficit460 Pa 451–469

Wind speed3.60 m/s 3.50–3.70

Cloud cover41.8 % 41.8–41.9

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)