Veronicastrum sibiricum

(L.) Pennell · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronicastrum

At a glance

Occurrence records1 250

Data sources12

Biological traits33

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Veronicastrum sibiricum's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 250 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources33 traits

Chemical compositionLOTUS · NPASS53 compounds

Occurrence & distributionGBIF1 250 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Veronicastrum sibiricum, the Sibirian veronicastrum, is a plant in the plantain family, Plantaginaceae.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology15

Fruit length3.5 mm

Fruit length max3.5 mm

Fruit length min3.5 mm

Leaf length115 mm

Leaf length max150 mm

Leaf length min80 mm

Leaf width30 mm

Leaf width max45 mm

Leaf width min15 mm

Plant height0.13 m

⚠ sources differ — GIFT: 0.13 m · TRY: 0.8 m

Plant height max1.5 m

Plant height min0.1 m

Seed mass0.07 mg

Seed mass max0.07 mg

Seed mass min0.07 mg

Life cycle & reproduction6

Flowering endJul

Flowering startJul

Life formperennial or rhizomatous geophyte

Life spanperennial

Lifespan years3 years

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 500 m

Elevation mean2 500 m

Elevation min2 500 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, meadows: wet, mountains, shrubberies

Woodinessnon-woody

Other traits1

Shoot orientationerect

03Chemical composition53 compounds

Compounds documented for Veronicastrum sibiricum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monosaccharides4

Abietane diterpenoids $ Naphthoquinones3

Abietane diterpenoids $ Furanoabietane diterpenoids2

Secoabietane diterpenoids2

Abietane diterpenoids $ Secoabietane diterpenoids2

Documented compounds53 total

Tissue Source Quantified only

Compound	Amount	Source
1,4-Phenanthrenedione, 7,8-dihydro-8,8-dimethyl-2-(1-methylethyl)-	present	LOTUS
1,6,6-Trimethyl-1,2,6,7,8,9-hexahydrophenanthro(1,2-b)furan-10,11-dione	present	NPASS
7-[4,5-Dihydroxy-6-(hydroxymethyl)-3-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxyoxan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-5-hydroxychromen-4-one	present	NPASS
Abamectin Component B1A	present	NPASS
AFSHKCWTGFDXJR-FSGZSHNRSA-N	present	NPASS
AFSHKCWTGFDXJR-NBHOAJIMSA-N	present	NPASS
AFSHKCWTGFDXJR-SQOHEDJBSA-N	present	NPASS
AZSNMRSAGSSBNP-LFOOHIAMSA-N	present	NPASS
CAJDUHQNQRQATN-MAMUBCSZSA-N	present	NPASS
Cryptotanshinone	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronicastrum sibiricum has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences9

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMH703309.1 ↗355 bpChina · 2014

ACGT

GGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATTCGGCTGAGGGCACGCCTGCCTGGGCG …

Veronicastrum sibiricum voucher Q538 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS4

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronicastrum sibiricum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidydiploid inferred

Chromosome records34–342n range34median34mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3411×CCDB · veronic · CCDB · ipcn-api-dl · CCDB · book-ipcn66 +2

CCDB · veronic — Cytotaxonomic studies in Veronica and related genera. | Ann. Rept. Natl. Inst. Genet. (Japan) | 9: 54 | 1958

CCDB · veronic — Geograficheskoy rasprostanie poliploidnich vidov rasteniy (Issledovanie flory primorskogo kraya | Vestnik. Leningr. Univ., ser. Biol | 1, 3: 92-106 | 1966

CCDB · veronic — Geographical distribution of polyploid species of plants (investigation of the flora of Sakhalin island) | Vestnik. Leningr. Univ., ser. Biol. | 21: 42-58 | 1960

CCDB · veronic — On the genus Pseudolysimachion | Journ. Jap. Bot. | 43: 405-412 | 1968

CCDB · veronic — Primenenie kariologiceskogo isledovanija k sistematike roda Veronica L. | Avtoref. kand. diss Kazan | 1-16 | 1965

CCDB · veronic — Weitere Chromosomenuntersuchungen bei Veronica-Arten der Sektion Psudolysimachia Koch. | Jahrb. Wissensch. Bot. | 81, 4: 609-662 | 1935

CCDB · veronic — Chromosome numbers of flowering plants in Korea | J. Korean Culture Research Inst. Ewha Womens's Univ | 11: 455-478 | 1967

CCDB · ipcn-api-dl — LEE, Y. N. 1967. Chromosome numbers of flowering plants in Korea. J. Korean Res. Inst. Ewha Women's Univ. 11: 455–478.

CCDB · book-ipcn66 — Sokolovs.kaya 1966

CCDB · book-ipcn67-71 — LEE, Y.N. 1967. Chromosome numbers of flowering plants in Korea (1) J. Korean Cult. Res. Inst. 11: 455-478.

CCDB · iapt — IAPT/IOPB Chromosome Data 27

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 250 records

Wild obs. + sensor711

Museum / vouchered536

Cultivated / captive2

Other1

Range

Area of Occupancy AOO2 996 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 191≤1 km 60≤10 km 44>10 km 233

528 georeferenced · 183 without coordinates

Open the mapobservation + sensor711

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy28% within 1 km

≤100 m 2≤1 km 9≤10 km 27>10 km 2

40 georeferenced · 496 without coordinates

Open the institutions mapphysical evidence536

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions23 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	108
Institute of Applied Ecology, Academia Sinicalocation not on record	83
Yangling, CN	55
Moscow State Universitylocation not on record	52
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	19
Lanzhou, CN	15
Xining, CN	15
Nanjing, CN	14
Sanda, JP	14
Herbarium of the Department of Botany, University of Tokyolocation not on record	13
KR	12
Northeastern Forestry Universitylocation not on record	10
Inner Mongolia Universitylocation not on record	10
Guangzhou, CN	9
Kyoto Universitylocation not on record	8
LDlocation not on record	7
Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record	6
IWEP FEB RASlocation not on record	6
东北师范大学自然博物馆location not on record	6
Shanxi Institute of Biologylocation not on record	6
WTUlocation not on record	5
SLU Artdatabankenlocation not on record	5
Kunming, CN	5
National Institute of Biological Resourceslocation not on record	5
Jiangxi College of Educationlocation not on record	4
Xian, CN	4
Beijing Normal Universitylocation not on record	3
Kushiro City Museumlocation not on record	3
Xian, CN	3
Shanghai, CN	3
Oskarshamn, SE	3
Kew, GB	2
WNNUlocation not on record	2
Philadelphia, US	2
JMSlocation not on record	2
Guangzhou, CN	2
Tsukuba, JP	1
Wuhan, CN	1
Chengdu, CN	1
Zhengzhou, CN	1
Shanghai, CN	1
ifplocation not on record	1
Peking Universitylocation not on record	1
Beijing Natural History Museumlocation not on record	1
Shenyang Agricultural Universitylocation not on record	1
Angwin, US	1
Chengdu, CN	1
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1

49 institutions · 534 of 536 vouchered records shown · 2 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Veronicastrum sibiricum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Veronicastrum sibiricum

At a glance

Sources12 archives

Size & morphology15

Life cycle & reproduction6

Diet & foraging1

Habitat & environment10

Other traits1

Compound class profile5 classes

Documented compounds53 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 250 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions23 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 250 records