Veronica verna
speciesAt a glance
Occurrence records29 299
Data sources13
Biological traits57
DNA specimens26
eDNA detections15
Sources13 archives
Databases and archives Veronica verna's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility29 299 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics26 specimens↗
NCBIUS National Library of Medicinesequences↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page6 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources57 traits
Occurrence & distributionGBIF29 299 records
Environmental DNA1 datasets · 5 countries15 detections
DNA & barcodingBOLD · NCBI26 specimens
Genome at a glanceCCDB · GoaT · NCBI577 Mbp
01Narrative
Veronica verna is a species of flowering plant belonging to the family Plantaginaceae. Its native range is Morocco, Europe to Southwestern Siberia and Himalaya.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTLEDATRY
Size & morphology24
Fruit length3 mm
Fruit length max3 mm
Fruit length min3 mm
Fruit width4 mm
Fruit width max4 mm
Fruit width min4 mm
Leaf length8.5 mm
Leaf length max12 mm
Leaf length min5 mm
Leaf size32 mm²
Leaf width5.5 mm
Leaf width max7 mm
Leaf width min4 mm
Plant height0.103 m
⚠ sources differ — GIFT: 0.103 m · LEDA: 0.09 m · TRY: 0.104 m
Plant height generative0.09 m
Plant height max0.25 m
Plant height min0.02 m
Seed length1.05 mm
Seed mass0.11 mg
⚠ sources differ — TRY: 0.11 mg · LEDA: 0.128 mg · GIFT: 0.109 mg
Seed mass max0.15 mg
Seed mass min0.05 mg
Seed volume0.082 mm³
Seed volume max0.082 mm³
Seed volume min0.082 mm³
Life cycle & reproduction14
Deciduousnessvernal
⚠ sources differ — TRY: vernal · GIFT: deciduous
Dehiscencedehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: endozoochor · GIFT: unspecialized
Flowering endJul
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number60
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean2 500 m
Elevation min2 500 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTmeadows: dry, mountains, sand, steppe, stony places
Mycorrhiza type0.0000000185
Woodinessnon-woody
Physiology & chemistry3
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)39.92 mm²/mg
Other traits1
Diaspore typeseed
05DNA & barcoding26 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica verna has left across the world's sequence archives.
At a glance
DNA specimens26
Marker genes5
GenBank sequences10
eDNA detections15
Countries7
The DNA barcodea real sequence read deposited for this species
TAGACCGCGAACACGTGTTAATCAACTCGTCGTACGGGCGCTTGCGCCCGAACGGCTAACGAACCCCGGCGCGGAAAGCGCCAAGGAAAA …
Veronica verna voucher GLM-F076762 from Germany internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Veronica verna carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size577 020 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Veronica verna0.58 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 16 n = 8
Ploidy2× diploid · measured
Chromosome records14–422n range16median16mode58records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 1648×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +12
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — CORRIAS B. - 1980. Numeri cromosomici per la flora italiana:696-700.. Inform. Bot. Ital. , 12(2): 121-123.
CCDB · ita-fl — Contandriopoulos J. - 1962. Recherches sur la flore endmique de la Corse et sur ses origines. Annales de la Facult des Sciences de Marseille , 32: 1-351.
CCDB · slov-fl — Váchová M. & Feráková V., 1980: [Report], pp. 722-723. - In: Löve Á. (ed.), Chromosome numbers reports LXIX, Taxon 29 /5-6.
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3642
CCDB · fl-europaea — Contandriopoulos,
CCDB · veronic — Contributions to a cytological catalogue of the British and Irish flora, 5 | Watsonia | 21: 365-368 | 1997
CCDB · veronic — Caryologie et localisation des espces vgtales endmiques de la Corse | Bull. Soc. Bot. France | 104: 53-55 | 1957
CCDB · veronic — Khromosomnye chisla nekotorykh vidov flory Belorussii. | Izv. Akad. Nauk Belorussk. SSR, ser. Biol. Nauk (Minsk) | 2: 7-12 | 1983
CCDB · veronic — Chromosome number reports LXIX. | Taxon | 29: 703-730 | 1980
CCDB · veronic — Floristic reports from the high mountains of Sterea Ellas, Greece 1 | Bot. Notiser | 131: 7-25 | 1978
CCDB · veronic — Chromosome numbers in South Swedish vascular plants | Opera Botanica | 137: 1-42 | 1999
CCDB · veronic — Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part. II. | Ber. Schweiz. Bot. Ges. | 85: 210-252 | 1975
CCDB · veronic — Hromosomnye cisla vidov roda Veronica (Scrophulariaceae) v Belorussii | Bot. Zurn. | 86/8: 144-147 | 2001
CCDB · veronic — IOPB chromosome number reports LXXVI. | Taxon | 31: 574-575 | 1982
CCDB · veronic — Chromosome counts of vascular plants of the island Seili in Nauvo, SW Finland. (In Finnsh). | Turun Yliopiston Biologian-Laitoksen Julkaisuja | 3: 1-12 | 1982
CCDB · veronic — Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija | Evoljucija na cvetnite rastenija i florogenez | 1: 72-106 | 1978
CCDB · veronic — Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion, Paederota, Wulfenia und Lagotis (Scrophulariaceaea-Veronicinae). | Oesterr. Bot. Zeits. | 116: 430-443 | 1969
CCDB · veronic — Numeri cromosomici per la Flora Italiana: 696-700 | Inform. Bot. Ital. | 12:121-123 | 1980
CCDB · veronic — Die Sektion Alsinebe Griseb. der Gattung Veronica in ihren chromosomalen Grundlagen. | Jahrb. Wissensch. Bot. Ges., | 81, 4: 541-572 | 1935
CCDB · veronic — | | | submitted
CCDB · ipcn-api-dl — Kirschner, J., J. Stepanek & J. Stepankova. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 574–575.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — Dmitrieva, S. A. & V. I. Parfenov. 1983. Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk 2: 7–12.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Vachova, M. & V. Ferakova. 1980. In Chromosome number reports LXIX. Taxon 29: 722–723.
CCDB · ipcn-api-dl — Dzhus, M. A. & S. A. Dmitrieva. 2001. Chromosome numbers in the species of the genus Veronica (Scrophulariaceae) from Byelorussia. Bot. Žhurn. (Moscow & Leningrad) 86(8): 144–147.
CCDB · ipcn-api-dl — Corrias, B. 1980. Numeri cromosomici per la Flora Italiana: 696-700. Inform. Bot. Ital. 12: 121–123.
CCDB · book-ipcn67-71 — CONTANDRIOPOULOS, J. 1962. Recherches sur la flore endemique de la Corse et sur ses origines. Ann. Faculte Sci. Marseille 32: 1-354.
CCDB · book-ipcn75-78 — Gustavsson 1978a
CCDB · book-indian_vol1 — Hofelich, A. 1935 ; Mehra, P.N. & Vasudevan, K.N. 1972
CCDB · eflora
CCDB · book-atlas-flowering-plants — Hofelich 1935
CCDB · kew — Albach DC, Greilhuber J. 2004. Genome size variation and evolution in Veronica. Annals of Botany 94: 897-911.
CCDB · CromoCat 2015 — Fischer, M. (1969). Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion Paederota, Wulfenia und Lagotis (Scrophulariaceae-Veronicinae). Österr. Bot. Z. 116: 430-443.
CCDB · CromoCat 2015 — Agudo, J. A. S., Sánchez, L .D., Martinez-Ortega, M. M., Martín, F.G. & Rico, E. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1795-1795
CCDB · CromoCat 2015 — Arohonka, T. (1982). Kromosomilukumäärityksiä Nauvon Seilin saaren putkilokasveista. (Chromosome counts of vascular plants of the island Seiliin Nauvo, SW Finland) Turun Yliopiston Biologian Laitoksen Julkaisuja 3: 1-12.
CCDB · CromoCat 2015 — Dmitrieva, S. A. & Parfenov, V. I. (1983). Khromosomnye chisla nekotorykh vidov flory Belorussii. Izv. Akad. Nauk Belorussk. SSR, Ser. Biol. Nauk (Minsk) 2: 7-12.
CCDB · CromoCat 2015 — Kirschner, J., Stepánek, J. & Stepánkova, J. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVI]. Taxon 31(3): 574-575.
+3 more references
2n 424×CCDB · new-zealand · CCDB · veronic · CCDB · book-ipcn67-71
CCDB · new-zealand
CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora. - 13. Parahebe and Pygmea (Scrophulariaceae) | New Zealand J. Bot. | 8: 255-259 | 1970
CCDB · book-ipcn67-71 — HAIR, J.B. 1970. Contributions to a Chromosome Atlas of the New Zealand flora. 13. Parahebe and Pygmea (Scrophulariaceae). New Zealand J. Bot. 8: 255-259.
2n 143×CCDB · book-ipcn67-71 · CCDB · book-indian_vol1
CCDB · book-ipcn67-71 — FISCHER, M. 1969. Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion Paederota, Wulfenia und Lagotis (scrophulariaceae-Veronicinae). oesterr. Bot. Zeits. 116: 430-443.
CCDB · book-indian_vol1 — Fischer, M. 1969
CCDB · book-indian_vol1 — Bhattacharyya, N.K. 1967
2n 243×CCDB · iapt · CCDB · veronic
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · veronic — | | | submitted
2n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Agudo, J. A. S., Sánchez, L .D., Martinez-Ortega, M. M., Martín, F.G. & Rico, E. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1795-1795
n 89×CCDB · iapt · CCDB · veronic · CCDB · book-ipcn72 +2
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · veronic — IOPB chromosome number reports XXXVI. | Taxon | 21: 333-346 | 1972
CCDB · veronic — Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion, Paederota, Wulfenia und Lagotis (Scrophulariaceaea-Veronicinae). | Oesterr. Bot. Zeits. | 116: 430-443 | 1969
CCDB · veronic — | | | submitted
CCDB · book-ipcn72 — MEHRA, P.N . & K.N. VASUDEVAN. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · CromoCat 2015 — Mehra, P. N. & K. N. Vasudevan. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVI]. Taxon 21(2/3): 341-344.
CCDB · CromoCat 2015 — Agudo, J. A. S., Sánchez, L .D., Martinez-Ortega, M. M., Martín, F.G. & Rico, E. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1795-1795
CCDB · CromoCat 2015 — Fischer, M. (1969). Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion Paederota, Wulfenia und Lagotis (Scrophulariaceae-Veronicinae). Österr. Bot. Z. 116: 430-443.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Agudo, J. A. S., Sánchez, L .D., Martinez-Ortega, M. M., Martín, F.G. & Rico, E. (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1795-1795
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.984 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness95.7% BUSCO
07Deep time~8.69 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin8.69 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
08Occurrence & distribution
Record type29 299 records
Wild obs. + sensor24 784
Museum / vouchered4 356
Cultivated / captive8
Other151
Origin
Native186
Introduced2
Range
Area of Occupancy AOO62 308 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy49% within 1 km
≤100 m 6 785≤1 km 4 052≤10 km 10 743>10 km 350
21 930 georeferenced · 2 854 without coordinates
Open the mapobservation + sensor24 784
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy52% within 1 km
≤100 m 605≤1 km 744≤10 km 1 032>10 km 192
2 573 georeferenced · 1 783 without coordinates
Open the institutions mapphysical evidence4 356
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 7
7 georeferenced · 1 without coordinates
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions73 of 150 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 289 |
| Olocation not on record | 281 |
| LDlocation not on record | 278 |
| Moscow State Universitylocation not on record | 264 |
| Uppsala, SE | 196 |
| Tartu, EE | 137 |
| BFLlocation not on record | 112 |
| BRNUlocation not on record | 110 |
| Turku, FI | 95 |
| Mlocation not on record | 91 |
| South Kensington, GB | 89 |
| Oulu, FI | 87 |
| SLU Artdatabankenlocation not on record | 83 |
| Oskarshamn, SE | 73 |
| Zürich, CH | 65 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 65 |
| TUR-Alocation not on record | 57 |
| Adam Mickiewicz University in Poznańlocation not on record | 57 |
| Görlitz, DE | 52 |
| Christchurch, NZ | 48 |
| Philadelphia, US | 47 |
| MeiseBGlocation not on record | 46 |
| Barcelona, ES | 41 |
| Uniwersytet Warszawskilocation not on record | 41 |
| Tallinn, EE | 40 |
| Zürich, CH | 38 |
| IFR-DNFlocation not on record | 38 |
| MAlocation not on record | 37 |
| PRClocation not on record | 32 |
| Trondheim, NO | 32 |
| Entomological Society of Latvialocation not on record | 29 |
| Berlin, DE | 29 |
| Jyväskylä, FI | 28 |
| Moscow, US | 28 |
| Ann Arbor, US | 26 |
| Provincia di Livornolocation not on record | 25 |
| València, ES | 25 |
| DBF-NHMDlocation not on record | 25 |
| Salamanca, ES | 25 |
| BDBClocation not on record | 25 |
| Naturhistorische Gesellschaft Nürnberg e.V.location not on record | 23 |
| Wlocation not on record | 22 |
| Vitoria, ES | 18 |
| Helsinki, FI | 18 |
| Madison, US | 18 |
| WTUlocation not on record | 17 |
| Bern, CH | 17 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 16 |
| BClocation not on record | 16 |
| Corvallis, US | 15 |
| Missoula, US | 15 |
| Bergen, NO | 15 |
| Madrid, ES | 13 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 12 |
| Bozeman, US | 12 |
| Forssa, FI | 12 |
| Wellington, NZ | 11 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 11 |
| St. Paul, US | 11 |
| Green Bay, US | 11 |
| BIO-UNIPIlocation not on record | 10 |
| Sion, CH | 10 |
| Dresden, DE | 10 |
| Porvoo, FI | 9 |
| Kuopio, FI | 9 |
| Vancouver, CA | 9 |
| Department of Bacteriology, University of Wisconsinlocation not on record | 8 |
| Salzburg, AT | 8 |
| Pullman, US | 7 |
| Toronto, CA | 7 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 7 |
| SNSNMClocation not on record | 7 |
| TROMlocation not on record | 7 |
| Victoria, CA | 7 |
| CJBGlocation not on record | 6 |
| Auckland, NZ | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Nanjing, CN | 6 |
| Museo Achille Folettolocation not on record | 6 |
| Stockholm, SE | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| Whitehorse, CA | 5 |
| Fulda, DE | 5 |
| John May Museum of Natural Historylocation not on record | 5 |
| Granada, ES | 4 |
| Paris, FR | 4 |
| Salvador, BR | 3 |
| Phyletisches Museum Jenalocation not on record | 3 |
| Hobart, AU | 3 |
| Sant Julià de Lòria, AD | 3 |
| KMNlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| UGentlocation not on record | 3 |
| NMBU:MINAlocation not on record | 3 |
| Pamplona, ES | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Bourges, FR | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| San Sebastián, ES | 2 |
| McWane Science Centerlocation not on record | 2 |
| Alicante, ES | 2 |
| Frankfurt am Main | 2 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 2 |
| University of Trondheim, Museum of Natural History and Archeologylocation not on record | 2 |
| Urumqi, CN | 2 |
| Bronx, US | 2 |
| Porrentruy, CH | 2 |
| Research Collection of B. A. Bennettlocation not on record | 2 |
| No collectionlocation not on record | 2 |
| DULlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| nbflocation not on record | 2 |
| Acadia Universitylocation not on record | 2 |
| Universität Göttingenlocation not on record | 2 |
| Saint John, CA | 2 |
| Dhaka, BD | 2 |
| Xiamen, CN | 2 |
| GMBAlocation not on record | 2 |
| NMWlocation not on record | 1 |
| SZUlocation not on record | 1 |
| H-Adlerlocation not on record | 1 |
| Guangzhou, CN | 1 |
| Beijing, CN | 1 |
| Musée des Confluenceslocation not on record | 1 |
| National Museum Waleslocation not on record | 1 |
| Canberra, AU | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 1 |
| Wuzhou, CN | 1 |
| Dekalb, US | 1 |
| Kew, GB | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| Santiago de Compostela, ES | 1 |
| CJBNlocation not on record | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| GJOlocation not on record | 1 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 1 |
| Moscow University Herbarium (MW)location not on record | 1 |
| Jaén, ES | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Logan, US | 1 |
| IPE-CSIClocation not on record | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| Université Lavallocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Rovaniemi, FI | 1 |
| Chongqing Museumlocation not on record | 1 |
| BioFokuslocation not on record | 1 |
150 institutions · 3 777 of 4 356 vouchered records shown · 565 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA15 detections
Where the DNA of Veronica verna was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found15
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 15 detections have coordinates
Open the map5 countries0
Rare Plants Nursery, Grown in polytunnel
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.3 °C 8.80–17.0
Seasonal swing summer↔winter23.3 °C
Max temp (day)14.2 °C 11.7–22.6
Min temp (night)6.60 °C 4.50–11.5
Precipitation79.6 mm/mo 42.4–113
Air humidity58.0 % 55.5–64.8
Moisture balance-47.2 mm/mo -58.1–50.3
Vapour deficit538 Pa 473–835
Wind speed4.10 m/s 2.20–5.60
Cloud cover46.0 % 37.9–52.2
CHELSA 1981–2010, ~9 km grid, at location & month of 10 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.