Veronica turrilliana

Stoj. & Stef. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records52

Data sources12

Biological traits8

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Veronica turrilliana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility52 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources8 traits

Chemical compositionLOTUS · NPASS22 compounds

Occurrence & distributionGBIF52 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 16

01Narrative

Veronica turrilliana () is a species of speedwell in the family Plantaginaceae, endemic to the Strandzha mountain range in south-eastern Bulgaria and north-western Turkey. It is included in the Red Book of Bulgaria as an endangered species. and is categorized as data deficient by the International Union for Conservation of Nature (IUCN). It was described in 1923 by the Bulgarian botanists Nikolai Stojanov and Boris Stefanoff.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Seed mass0.459 mg

Life cycle & reproduction3

Life formsubshrub

Life spanperennial

Raunkiær life formchamaephyte

Habitat & environment4

Aquaticterrestrial

Climatetemperate

Growth formshrub

Woodinesswoody

03Chemical composition22 compounds

Compounds documented for Veronica turrilliana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile4 classes

Iridoids monoterpenoids20

Cinnamic acids and derivatives $ Phenylethanoids4

Spirostane steroids3

Cinnamic acids and derivatives2

Documented compounds22 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,1bS,2S,5aR,6S,6aS)-1a,1b,2,5a,6,6a-Hexahydro-6-hydroxy-1a-(hydroxymethyl)oxireno[4,5]cyclopenta[1,2-c]pyran-2-yl-beta-D-glucopyranoside	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-6-[(1R,2S,3'S,4S,5'S,6S,7S,8R,9S,10R,12S,13R,16S)-3',10-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4,5-dihydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-6-[(1R,2S,3'S,4S,5'S,6S,7S,8S,9S,10R,12S,13R,16S)-3',10-dihydroxy-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-4,5-dihydroxy-2-(hydroxymethyl)oxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5R,6R)-2-[[(1S,4aS,5R,7aS)-5-hydroxy-7-(hydroxymethyl)-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-1-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2S,3R,4S,5S,6R)-2-[[(1S,2S,4S,5S,6S,10S)-5-hydroxy-2-(hydroxymethyl)-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(Hydroxybenzoyl)catalpol; Catalpol 6-p-hydroxybenzoate	present	LOTUS
2-(Hexopyranosyloxy)-1a-(hydroxymethyl)-1a,1b,2,5a,6,6a-hexahydrooxireno[2',3':4,5]cyclopenta[1,2-c]pyran-6-yl 3,4-dihydroxybenzoate	present	LOTUS
6-O-Caffeoylarbutin	present	LOTUS
[(1S,2S,4S,5S,6S,10S)-2-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-5-yl] 3-hydroxy-4-methoxybenzoate	present	LOTUS
[(1S,2S,4S,5S,6S,10S)-2-(hydroxymethyl)-10-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-5-yl] 4-hydroxybenzoate	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica turrilliana has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences3

eDNA detections2

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKT361708.1 ↗630 bpBulgaria

ACGT

GTAGGTGAACCTGCGGAAGGATCATTGTCGATGCCTGTAAATCAGACCGCGAACACGTGTTAATAAGCTCCGTTCGCTCAGCGCTGCGCT …

Veronica turrilliana voucher SALA 149334 (MS1247-1) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS3

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica turrilliana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–162n range16median16mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 162×CCDB · veronic

CCDB · veronic — IOPB chromosome number reports XXXVIII. | Taxon | 21: 495-500 | 1972

CCDB · veronic — Chromosomenzahlen und Strukturen der Arbeitskerne diverser Angiospermen | Naturk. Jahrb. Stadt Linz | 20: 155-180 | 1974

n 81×CCDB · veronic

CCDB · veronic — Nouvelle contribution la cytologie du genre Veronica. | Bull. Soc. Neuchtel. Sci. Nat. | 76: 111-119 | 1953

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=0.981 ↗

08Occurrence & distribution

Record type52 records

Wild obs. + sensor4

Museum / vouchered48

Range

Area of Occupancy AOO28 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 3

3 georeferenced · 1 without coordinates

Open the mapobservation + sensor4

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1≤1 km 1

2 georeferenced · 46 without coordinates

Open the institutions mapphysical evidence48

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salamanca, ES	43
BRNUlocation not on record	2
Denver, US	1
BG-NMNHSlocation not on record	1

4 institutions · 47 of 48 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Veronica turrilliana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)