Veronica tetragona

Hook. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records359

Data sources7

Biological traits5

DNA specimens2

eDNA detections2

Sources7 archives

Databases and archives Veronica tetragona's data was compiled from.

GBIFGlobal Biodiversity Information Facility359 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources5 traits

Occurrence & distributionGBIF359 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 40

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Deciduousnessevergreen

Life formsubshrub

Life spanperennial

Habitat & environment2

Climatesubalpine or subarctic

Woodinesswoody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica tetragona has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSAF069467.1 ↗550 bpNew Zealand

ACGT

TTCNCCCGCTAGACCTCGCGTTTAGCGGGCTTAGAACCCCGGCGCGGCATGCGCCAAGGAAAACTCAAAGGAAGCGTCGCCCCCGTGATG …

Veronica tetragona isolate R Mole internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica tetragona carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · new-zealand · CCDB · veronic · CCDB · book-ipcn67-71

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type359 records

Wild obs. + sensor317

Museum / vouchered42

Range

Area of Occupancy AOO704 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy76% within 1 km

≤100 m 179≤1 km 32≤10 km 57>10 km 9

277 georeferenced · 40 without coordinates

Open the mapobservation + sensor317

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 37 without coordinates

Open the institutions mapphysical evidence42

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	19
Christchurch, NZ	12
Palmerston North, NZ	4
Museo Entomologico de Leonlocation not on record	3
Hobart, AU	1
Chicago, US	1

6 institutions · 40 of 42 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Veronica tetragona was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)