Veronica strictissima

(Kirk) Garn.-Jones · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records478

Data sources9

Biological traits18

DNA specimens1

eDNA detections1

Sources9 archives

Databases and archives Veronica strictissima's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility478 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources18 traits

Chemical compositionLOTUS7 compounds

Occurrence & distributionGBIF478 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 80

01Narrative

Veronica strictissima, the Banks Peninsula hebe, is a species of flowering plant in the family Plantaginaceae. It is only found on Banks Peninsula in New Zealand.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFT

Size & morphology11

Leaf length max32 mm

Leaf width7 mm

Leaf width max7 mm

Leaf width min7 mm

Plant height max2 m

Seed length1.3 mm

Seed length max1.3 mm

Seed length min1.3 mm

Seed mass0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction3

Life spanperennial

Raunkiær life formphanerophyte

Reproduction asexualabsent

Habitat & environment4

Climatetemperate

Growth formshrub

Habitat GIFTCoastal

Woodinesswoody

03Chemical composition7 compounds

Compounds documented for Veronica strictissima across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones6

Flavonols1

Documented compounds7 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
6-Hydroxyluteolin	present	LOTUS
Apiumetrin	present	LOTUS
Hypolaetin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS
Luteolin 7-glucuronide	present	LOTUS
Vicenin-2	present	LOTUS

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica strictissima has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences1

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ630663.1 ↗619 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGTAAATCGAACCGCGAACACGTGTACATGAATTCGCCCGCTAGACGCTC …

Veronica strictissima voucher WELT SP080809 Bayly & Kellow MJB99a 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica strictissima carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 80 n = 40

Ploidypolyploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 403×CCDB · veronic

CCDB · veronic — | New Zealand Hebes, an illustrated guide | | 2006, in press

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type478 records

Wild obs. + sensor395

Museum / vouchered83

Range

Area of Occupancy AOO548 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 235≤1 km 46≤10 km 15>10 km 2

298 georeferenced · 97 without coordinates

Open the mapobservation + sensor395

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy67% within 1 km

≤1 km 2≤10 km 1

3 georeferenced · 80 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	48
Wellington, NZ	32
Hobart, AU	2
Museo Entomologico de Leonlocation not on record	1

4 institutions · 83 of 83 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Veronica strictissima was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)