Veronica stricta

Banks & Sol. ex Benth. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records2 222

Data sources10

Biological traits28

DNA specimens0

eDNA detections0

Sources10 archives

Databases and archives Veronica stricta's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 222 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS60 compounds

Occurrence & distributionGBIF2 222 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

01Narrative

Hebe stricta, commonly called koromiko, is a flowering plant in the family Plantaginaceae, which is endemic to New Zealand. Recently Hebe stricta has been reclassified and the botanical name has changed to Veronica stricta. A hebe found throughout the Mainland New Zealand, with long pale green leaves and tiny white flowers in summer formed into a dense inflorescence longer than the leaves. The koromiko is a hardy plant and does not tolerate shade. It prefers full sun and open habitats on edge of bush and wetlands as it tolerates wet areas.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology14

Fruit length4 mm

Fruit width3 mm

Leaf length max75 mm

Leaf width15 mm

Leaf width max15 mm

Leaf width min15 mm

Plant height2.5 m

Plant height max4 m

Seed length1 mm

Seed length max1 mm

Seed length min1 mm

Seed mass0.079 mg

⚠ sources differ — TRY: 0.079 mg · GIFT: 0.055 mg

Seed mass max0.06 mg

Seed mass min0.05 mg

Life cycle & reproduction7

Deciduousnessevergreen

Dispersal typeunspecialized

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Habitat & environment4

Climatetemperate

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Shrub, treee (ST)

Habitat GIFTLowland

Woodinesswoody

Physiology & chemistry3

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

Specific leaf area (SLA)6.53 mm²/mg

03Chemical composition60 compounds

Compounds documented for Veronica stricta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Isoquinoline alkaloids21

Flavanones4

Flavones4

Amarylidaceae alkaloids2

Isoquinoline alkaloids $ Tetrahydroisoquinoline alkaloids2

Documented compounds60 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-7-Hydroxyflavanone	present	NPASS
(-)-Argemonine	present	NPASS
(-)-Isoboldine	present	NPASS
(-)-N-methylcaryachine	present	NPASS
(-)-Pinostrobin	present	NPASS
(1'S,2R,4R)-10,11-dimethoxy-5-methylspiro[5-azatricyclo[6.3.1.04,12]dodeca-1(12),8,10-triene-2,6'-cyclohex-2-ene]-1'-ol	present	NPASS
(1'S,2S,4R)-10,11-dimethoxy-5-methylspiro[5-azatricyclo[6.3.1.04,12]dodeca-1(12),8,10-triene-2,4'-cyclohex-2-ene]-1'-ol	present	NPASS
(1'S,2S,4R)-10-methoxy-5-methylspiro[5-azatricyclo[6.3.1.04,12]dodeca-1(12),8,10-triene-2,4'-cyclohex-2-ene]-1',11-diol	present	NPASS
(1R,12R)-15-methoxy-20-methyl-5,7-dioxa-20-azapentacyclo[10.7.1.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaen-16-ol	present	NPASS
(1R,12R,20S)-15,16-dimethoxy-20-methyl-20-oxido-5,7-dioxa-20-azoniapentacyclo[10.7.1.02,10.04,8.013,18]icosa-2,4(8),9,13,15,17-hexaene	present	NPASS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica stricta has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ630662.1 ↗615 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGTAAATCGAACCGCGAACACGTGTCATGAATTCGCCCGCTAGACGTCGC …

Veronica stricta voucher WELT SP098959 Low LOWKB2 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica stricta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–1002n range40median40mode10records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 406×CCDB · new-zealand · CCDB · veronic · CCDB · ipcn-api-dl +1

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 35. Miscellaneous families | New Zealand J. Bot. | 37: 511-521 | 1999

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · ipcn-api-dl — Murray, B. G. & P. J. d. Lange. 1999. Contributions to a chromosome atlas of the New Zealand flora---35. Miscellaneous families. New Zealand J. Bot. 37: 511–521.

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

2n 803×CCDB · new-zealand · CCDB · veronic

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 35. Miscellaneous families | New Zealand J. Bot. | 37: 511-521 | 1999

2n 1001×CCDB · new-zealand

CCDB · new-zealand

n 2010×CCDB · veronic · CCDB · book-ipcn67-71

CCDB · veronic — | New Zealand Hebes, an illustrated guide | | 2006, in press

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

n 401×CCDB · veronic

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type2 222 records

Wild obs. + sensor2 115

Museum / vouchered107

Origin

Native1

Introduced1

Range

Area of Occupancy AOO4 936 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 1 453≤1 km 213≤10 km 62>10 km 33

1 761 georeferenced · 354 without coordinates

Open the mapobservation + sensor2 115

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy45% within 1 km

≤100 m 1≤1 km 4≤10 km 6

11 georeferenced · 96 without coordinates

Open the institutions mapphysical evidence107

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	54
Wellington, NZ	28
Palmerston North, NZ	13
Hobart, AU	4
Museo Entomologico de Leonlocation not on record	3
Moscow State Universitylocation not on record	2
Uniwersytet Śląski w Katowicachlocation not on record	1
Mount Annan, AU	1
Auckland, NZ	1

9 institutions · 107 of 107 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Veronica stricta

At a glance

Sources10 archives

Size & morphology14

Life cycle & reproduction7

Habitat & environment4

Physiology & chemistry3

Compound class profile5 classes

Documented compounds60 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 222 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions6 of 9 geolocated

Record type2 222 records