Veronica stenophylla

Steud. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records111

Data sources7

Biological traits5

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Veronica stenophylla's data was compiled from.

GBIFGlobal Biodiversity Information Facility111 records↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources5 traits

Chemical compositionLOTUS8 compounds

Occurrence & distributionGBIF111 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 40

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction2

Deciduousnessevergreen

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formShrub (S)

Woodinesswoody

03Chemical composition8 compounds

Compounds documented for Veronica stenophylla across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Flavones7

Flavonols1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
2-(3,4-dihydroxyphenyl)-5,6-dihydroxy-7-[(2S,3S,4S,5S,6S)-3,4,5-trihydroxy-6-[[(2S,3S,4S,5S)-3,4,5-trihydroxyoxan-2-yl]oxymethyl]oxan-2-yl]oxychromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-((2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl)oxychromen-4-one	present	LOTUS
2-(3,4-dihydroxyphenyl)-7-[(2R,3R,4R,5S)-4,5-dihydroxy-3-[(2R,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5,6-dihydroxychromen-4-one	present	LOTUS
6,7-Dimethylscutellarein	present	LOTUS
6-Hydroxyluteolin	present	LOTUS
7-[(2R,3R,4R,5S)-4,5-dihydroxy-3-[(2R,3R,4R,5S)-3,4,5-trihydroxyoxan-2-yl]oxyoxan-2-yl]oxy-5,6-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one	present	LOTUS
Hypolaetin	present	LOTUS
Luteolin 7-glucoside	present	LOTUS

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica stenophylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKJ630661.1 ↗621 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGTAAATCGAACCGCGAACACGTGTACATGAATTCGCCCGCTAGACGCTC …

Veronica steonophylla var. hesperia voucher WELT SP098927 Low & Garnock-Jones LOW02010 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica stenophylla carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidydiploid inferred

Chromosome records40–402n range40median40mode3records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 403×CCDB · new-zealand · CCDB · veronic

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 36. Miscellaneous families | New Zealand J. Bot. | 38: 1-23 | 2000

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

n 201×CCDB · veronic

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type111 records

Wild obs. + sensor94

Museum / vouchered17

Range

Area of Occupancy AOO340 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy86% within 1 km

≤100 m 50≤1 km 13≤10 km 4>10 km 6

73 georeferenced · 21 without coordinates

Open the mapobservation + sensor94

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 16 without coordinates

Open the institutions mapphysical evidence17

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Wellington, NZ	7
Christchurch, NZ	7
Palmerston North, NZ	2
Hobart, AU	1

4 institutions · 17 of 17 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)