Veronica spuria

species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records1 732

Data sources12

Biological traits28

DNA specimens4

eDNA detections24

Sources12 archives

Databases and archives Veronica spuria's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 732 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI24 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

Paleobiology DatabasePBDB consortiumfossil record↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Chemical compositionLOTUS · NPASS8 compounds

Occurrence & distributionGBIF1 732 records

Environmental DNA2 datasets · 1 countries24 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 34

01Narrative

Веро́ника ненастоя́щая, или Вероника ло́жная, или Вероника мете́льчатая — многолетнее травянистое растение, вид рода Вероника (Veronica) семейства Подорожниковые (Plantaginaceae).

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology5

Plant height1.2 m

Plant height max1.2 m

Plant height min0.3 m

Seed length1.1 mm

Seed mass0.105 mg

Life cycle & reproduction11

Deciduousnessevergreen

Dispersal typewind

Flowering endAug

Flowering startJul

Life formrhizomatous geophyte

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formhemicryptophyte

Self fertilizationpresent

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, meadows: dry, meadows: wet, mountains, rivers, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry2

Photosynthetic pathwayC3

Specific leaf area (SLA)8.88 mm²/mg

Other traits1

Diaspore typeseed

03Chemical composition8 compounds

Compounds documented for Veronica spuria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Monosaccharides3

Flavones2

Indole diketopiperazine alkaloids (L-Trp, L-Ala)1

Tripeptides1

Cyclic peptides $ Depsipeptides1

Documented compounds8 total

Tissue Source Quantified only

Compound	Amount	Source
(2S)-2-[[(2S)-2-[[(2S)-2-hydroxy-3-methylbutanoyl]amino]-3-methylbutanoyl]-methylamino]-4-methylpentanoic acid	present	NPASS
6-Hydroxyluteolin	present	NPASS
Apigenin	present	LOTUS
cyclo[N(Me)Ala-Ala-ObPhe(S)-ObPhe(S)-OVal]	present	NPASS
D-Mannitol	present	LOTUS
D-Sedoheptulose	present	NPASS
Mannitol	present	NPASS
Sporidesmin	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica spuria has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections24

Countries2

The DNA barcodea real sequence read deposited for this species

ITSPQ452697.1 ↗360 bpKazakhstan

ACGT

CGGGCGCATGCGCTGTGCCCGTTCCACCCACAAGTCGGGCGAGGATGGCTGGGTTGGCGCTGGCCCCGCTGGGGTGCGGCTCCCTCCCTC …

Veronica spuria voucher KS23 HER0553 internal transcribed spacer 1 and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★ITS5

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica spuria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidypolyploid inferred

Chromosome records34–682n range34median34mode15records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3413×CCDB · fl-europaea · CCDB · poland · CCDB · veronic +3

CCDB · fl-europaea — Graze, 1933

CCDB · poland — Pogan E., Jankun A., Wcis?o H. 1991. Further studies in chromosome numbers of Polish Angiosperms. Part XXIV. Acta Biol. Cracov. Ser. Bot. 33, 25-43.

CCDB · poland — Jankun A., Ma?ecka J., Izmai?ow R., Wcis?o H., Czapik R., Musia? K., et al. 1996 Further studies in chromosome numbers of Polish Angiosperms. Part XXV. Acta Biol. Cracov. Ser. Bot. 38, 9-27.

CCDB · veronic — Cytotaxonomic studies in Veronica and related genera. | Ann. Rept. Natl. Inst. Genet. (Japan) | 9: 54 | 1959

CCDB · veronic — Contribution l'tude caryologique et gntique des Veronica. | Compt. Rend. Soc. Biol. (Paris) | 117, 36: 1153-1156 | 1934

CCDB · veronic — Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija | Evoljucija na cvetnite rastenija i florogenez | 1: 72-106 | 1978

CCDB · veronic — Primenenie kariologiceskogo isledovanija k sistematike roda Veronica L. | Avtoref. kand. diss Kazan | 1-16 | 1965

CCDB · veronic — Further studies in chromosome numbers of Polish angiosperms. Part XXIV | Acta Biol. Cracov., Ser, Bot. | 33: 25-43 | 1991

CCDB · veronic — Die chromosomalen Verhltnisse in der Sektion Pseudolysimachia Koch der Gattung Veronica. | Jahrb. Wissensch. Bot. | 77, 4: 507-559 | 1933

CCDB · ipcn-api-dl — Travnicek. 2004. Karyo-taxonomic study of the genus Pseudolysimachion (Scrophulariaceae) in the Czech Republic and Slovakia. Folia Geobot. 39(2): 173–203.

CCDB · ipcn-api-dl — Izmai|1low, R. 1991. In Further studies in chromosome numbers of Polish angiosperms, part 24. Acta Biol. Cracov., Ser. Bot. 33: 27, 31–32, 34–35.

CCDB · eflora

CCDB · book-atlas-flowering-plants — Graze 1933

2n 682×CCDB · veronic · CCDB · book-ipcn72

CCDB · veronic — IOPB chromosome number reports XXXVIII. | Taxon | 21: 495-500 | 1972

CCDB · book-ipcn72 — PEEV, D. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 495-500.

n 176×CCDB · veronic

CCDB · veronic — Contribution l'tude caryologique et gntique des Veronica. | Compt. Rend. Soc. Biol. (Paris) | 117, 36: 1153-1156 | 1934

CCDB · veronic — Die chromosomalen Verhltnisse in der Sektion Pseudolysimachia Koch der Gattung Veronica. | Jahrb. Wissensch. Bot. | 77, 4: 507-559 | 1933

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 732 records

Wild obs. + sensor1 084

Museum / vouchered648

Origin

Introduced3

Range

Area of Occupancy AOO5 028 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy59% within 1 km

≤100 m 383≤1 km 103≤10 km 109>10 km 224

819 georeferenced · 265 without coordinates

Open the mapobservation + sensor1 084

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 32≤1 km 118≤10 km 107>10 km 46

303 georeferenced · 345 without coordinates

Open the institutions mapphysical evidence648

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 45 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	235
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	39
BRNUlocation not on record	33
KFGBlocation not on record	23
Taipei, TW	19
Urumqi, CN	18
LDlocation not on record	15
Servico de Microbiologia e Imunologialocation not on record	12
Beijing, CN	11
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	8
Samara National Research Universitylocation not on record	8
Adam Mickiewicz University in Poznańlocation not on record	7
Peking Universitylocation not on record	6
Tula State Universitylocation not on record	5
Uniwersytet Wrocławskilocation not on record	5
Wlocation not on record	4
Hangzhou, CN	4
Guangzhou, CN	4
Kostrzyca Forest Gene Banklocation not on record	3
Beijing Normal Universitylocation not on record	3
Prioksko-Terrasnyi Biosphere Reservelocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	2
Uniwersytet Opolskilocation not on record	2
Guangzhou, CN	2
MeiseBGlocation not on record	2
Xian, CN	2
Urumqi, CN	2
Burlington, US	1
Universität Göttingenlocation not on record	1
Chongqing Museumlocation not on record	1
Wuhan, CN	1
Nagasaki University - Fisherieslocation not on record	1
Chengdu, CN	1
Russellville, US	1
Stadt Seeland, Ortsteil Gatersleben, DE	1
Oskarshamn, SE	1
Keene State Universitylocation not on record	1
Awka, NG	1
Shanghai, CN	1
Salzburg, AT	1
Bronx, US	1
SXTCMlocation not on record	1
Berlin, DE	1
Podgorica, ME	1
GJOlocation not on record	1

45 institutions · 495 of 648 vouchered records shown · 153 without an institution code

09Environmental DNA24 detections

Where the DNA of Veronica spuria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found24

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 24 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 19.0–19.0

Seasonal swing summer↔winter21.5 °C

Max temp (day)23.1 °C

Min temp (night)14.5 °C

Precipitation90.1 mm/mo

Air humidity59.4 %

Moisture balance-43.6 mm/mo

Vapour deficit891 Pa

Wind speed3.50 m/s

Cloud cover31.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 23 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Veronica spuria

At a glance

Sources12 archives

Size & morphology5

Life cycle & reproduction11

Diet & foraging1

Habitat & environment8

Physiology & chemistry2

Other traits1

Compound class profile5 classes

Documented compounds8 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 732 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions20 of 45 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 732 records