Veronica spicata
speciesAt a glance
Occurrence records42 093
Data sources14
Biological traits39
DNA specimens39
eDNA detections29
Sources14 archives
Databases and archives Veronica spicata's data was compiled from.
WikipediaWikimedia Foundation10 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 093 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics39 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources39 traits
Chemical compositionLOTUS5 compounds
Occurrence & distributionGBIF42 093 records
Environmental DNA2 datasets · 7 countries29 detections
DNA & barcodingBOLD · NCBI39 specimens
Genome at a glanceCCDB · GoaT · NCBI1.6 Gbp
01Narrative
Veronica spicata (spiked speedwell; syn. Pseudolysimachion spicatum) is a species of flowering plant in the family Plantaginaceae. It is 1-3 ft tall and bears 1 foot long spikes with blue, pink, purple and white flowers. It is the county flower of Montgomeryshire in the United Kingdom. Cultivated varieties include blue ('Royal Candles'), red ('Red Fox') and white ('Noah Williams'). It became a protected species in the UK in 1975 under the Conservation of Wild Creatures and Wild Plants Act.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTLEDATRY
Size & morphology10
Leaf mass68.3 mg
Leaf size316 mm²
⚠ sources differ — TRY: 316 mm² · LEDA: 505 mm² · GIFT: 358 mm²
Plant height0.205 m
⚠ sources differ — GIFT: 0.205 m · LEDA: 0.21 m · TRY: 0.1 m
Plant height generative0.275 m
Plant height max0.5 m
Plant height min0.15 m
Seed length0.94 mm
Seed mass0.145 mg
⚠ sources differ — TRY: 0.145 mg · LEDA: 0.119 mg · GIFT: 0.169 mg
Seed mass max0.5 mg
Seed mass min0.066 mg
Life cycle & reproduction12
Deciduousnessevergreen
Dispersal typehuman
⚠ sources differ — LEDA: ethelochor · GIFT: anemochorous
Flowering endOct
Flowering startJun
Life formperennial
Life spanperennial
Lifespan years6 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Seed number127 910
Self fertilizationpresent
Diet & foraging1
Parasiteindependent
Habitat & environment8
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Growth formherb
Habitat GIFTforest, meadows, mountains, steppe, stony places
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry7
Leaf C:N ratio17.15 g/g
Leaf c474 mg/g
Leaf dry-matter content (LDMC)342 mg/g
Leaf n24.28 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)13.51 mm²/mg
⚠ sources differ — TRY: 13.51 mm²/mg · LEDA: 10.12 mm²/mg · GIFT: 11.72 mm²/mg
Other traits1
Diaspore typeseed
03Chemical composition5 compounds
Compounds documented for Veronica spicata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Flavones5
Documented compounds5 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3R,4R,5S,6R)-3,4,5-trihydroxy-6-[5-hydroxy-2-(4-hydroxyphenyl)-4-oxochromen-7-yl]oxyoxane-2-carboxylic acid | present | LOTUS | |
| Apigenin | present | LOTUS | |
| Apigenin 7-O-glucuronide | present | LOTUS | |
| Luteolin 7-diglucoside | present | LOTUS | |
| Luteolin 7-glucoside | present | LOTUS |
05DNA & barcoding39 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica spicata has left across the world's sequence archives.
At a glance
DNA specimens39
Marker genes6
GenBank sequences10
eDNA detections29
Countries8
The DNA barcodea real sequence read deposited for this species
CGCATCGCGTCGCCCCACTCCGCATCCCTACGGATTCGCGAGTGGCGCGGAAAATGGTCTCCCGTGTGCATCTTTGCACGTGGTTGGCCC …
Veronica spicata voucher ZX-8760 internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Veronica spicata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 623 480 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Veronica spicata1.62 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 68 n = 34
Ploidy4× tetraploid · measured
Chromosome records18–682n range68median68mode167records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 6894×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · fl-europaea +7
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · slov-fl — Májovský J. & Váchová M., 1986: Karyological study of the Slovak flora XIII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 63-67.
CCDB · slov-fl — Májovský J. et al., 1970a: Index of chromosome numbers of Slovakian flora (Part 1). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 16: 1-26.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Trávníček B., 1998: Notes on the taxonomy of Pseudolysimachion sect. Pseudolysimachion (Scrophulariaceae) in Europe. I. P. incanum and P. spicatum. - Preslia 70/3: 193-223.
CCDB · slov-fl — Trávníček B., Lysák M. A., Číhalíková J. & Doležel J., 2004: Karyo-taxonomic study of the genus Pseudolysimachion (Scrophulariaceae) in the Czech Republic and Slovakia. - Folia Geobotanica 39/2: 173-203.
CCDB · slov-fl — Trávníček B., 1997: 16. Pseudolysimachion (W. D. J. Koch) Opiz - Veronikovec, pp. 264-298. - In: Goliašová K. (ed.), Flóra Slovenska V/2. Veda, Bratislava.
CCDB · fl-europaea — Graze, 1933
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · veronic — Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. | Zapov. Belorussii Issl. | 10: 24-28 | 1986
CCDB · veronic — Further studies in chromosome numbers of Polish angiosperms. Part. XVI | Acta Biol. Cracov., Ser. Bot. | 24: 159-189 | 1982
CCDB · veronic — Chromosome numbers in vascular plants from Norwqy, including Svalbard. | Opera Bot. | 52: 1-38 | 1979
CCDB · veronic — Veronica spicata in Finland. | Symb. Bot. Upsal. | 27: 35-46 | 1986
CCDB · veronic — Chromosome numbers in vascular plants from Finland. | | 130: 1-37 | 1985
CCDB · veronic — Notes on the taxonomy of Pseudolysimachion sect. Pseudolysimachion (Scrophulariaceae) in Europe. I. P. incanum und P.spicatum | Preslia | 70:193-223 | 1998
CCDB · veronic — Chromosome numbers in South Swedish vascular plants | Opera Botanica | 137: 1-42 | 1999
CCDB · veronic — Chromosome numbers of vascular plants from Austria, Mallorca and Yugoslavia. | Bot. Notiser | 124: 270-276 | 1971
CCDB · veronic — Hromosomnye cisla vidov roda Veronica (Scrophulariaceae) v Belorussii | Bot. Zurn. | 86/8: 144-147 | 2001
CCDB · veronic — Index of chromosome numbers of Slovakian flora (Part 1) | Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica | 16: 1-26 | 1970
CCDB · veronic — | Karyotaxonomicky prehlad flory Slovenska, Veda Vydavatelsto Slovenskej Akademie vied, Bratislava | | 1987
CCDB · veronic — Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija | Evoljucija na cvetnite rastenija i florogenez | 1: 72-106 | 1978
CCDB · veronic — Karyological study of the Slovak flora XIII. | Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica | 33: 63-67 | 1986
CCDB · veronic — Application of the karyogeographical study to the phylogeny of genus Veronica L. | Bot. Zurn. | 46:247-259 | 1961
CCDB · veronic — Veronica | Flore Slovenska | 5/2: 286 | 1997
CCDB · veronic — Primenenie kariologiceskogo isledovanija k sistematike roda Veronica L. | Avtoref. kand. diss Kazan | 1-16 | 1965
CCDB · veronic — Weitere Chromosomenuntersuchungen bei Veronica-Arten der Sektion Psudolysimachia Koch. | Jahrb. Wissensch. Bot. | 81, 4: 609-662 | 1935
CCDB · veronic — Die chromosomalen Verhltnisse in der Sektion Pseudolysimachia Koch der Gattung Veronica. | Jahrb. Wissensch. Bot. | 77, 4: 507-559 | 1933
CCDB · veronic — Taxonomic studies on Veronica longifolia and V. spicata in Eastern Fennoscandia. | Ann. Bot. Fenn. | 4: 471-485 | 1967
CCDB · ipcn-api-dl — Dzhus, M. A. & S. A. Dmitrieva. 2001. Chromosome numbers in the species of the genus Veronica (Scrophulariaceae) from Byelorussia. Bot. Žhurn. (Moscow & Leningrad) 86(8): 144–147.
CCDB · ipcn-api-dl — Kukkonen, I. 1986. Veronica spicata in Finland. Symb. Bot. Upsal. 27: 35–46.
CCDB · ipcn-api-dl — Dmitrieva, S. A. 1986. Chisla khromosom nekotorych vidov rastenij Berezinskogo Biosfernogo Zapovednika. Zapov. Belorussii Issl. 10: 24–28.
CCDB · ipcn-api-dl — Lövkvist, B. & U. M. Hultgård. 1999. Chromosome numbers in south Swedish vascular plants. Opera Bot. 137: 1–42.
CCDB · ipcn-api-dl — Májovský, J. & M. Váchová. 1986. Karyological study of the Slovak flora XIII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 63–67.
CCDB · ipcn-api-dl — Trávníček, B. 1998. Notes on the taxonomy of Pseudolysimachion sect. Pseudolysimachion (Scrophulariaceae) in Europe. I. P. incanum and P. spicatum. Preslia 70: 193–223.
CCDB · ipcn-api-dl — Travnicek. 2004. Karyo-taxonomic study of the genus Pseudolysimachion (Scrophulariaceae) in the Czech Republic and Slovakia. Folia Geobot. 39(2): 173–203.
CCDB · book-ipcn73-74 — NILSSON, Q., & P. LASSEN. 1971. Chromosome numbers of vascular pla from Austria, Mallorca and Yugoslav1a. Bot. Not1ser 124: 270-276. I
CCDB · eflora
CCDB · book-atlas-flowering-plants
CCDB · CromoCat 2015 — Engelskjon, T. (1979). Chromosome numbers in vascular plants from Norway, including Svalbard. Opera Bot. 52: 1-38.
CCDB · CromoCat 2015 — Kukkonen, I. (1986). Veronica spicata in Finland Symbolae Botanicae Upsaliensis 27: 35-46
+4 more references
2n 3456×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +11
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GIORDANI A., MICELI P., MONTI G. - 1980. Numeri cromosomici per la flora italiana:789-793.. Inform. Bot. Ital. , 12(3): 327-332.
CCDB · slov-fl — Váchová M. & Feráková V., 1986: Karyological study of the Slovak flora XII. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 33: 57-62.
CCDB · slov-fl — Májovský J., Murín A., Feráková V., Hindáková M., Schwarzová T., Uhríková A., Váchová M. & Záborský J., 1987: Karyotaxonomický prehľad flóry Slovenska. Veda, Bratislava.
CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.
CCDB · slov-fl — Feráková V., Kochjarová J., Králik E., Schwarzová T. & Záborský J., 1997: Cievnaté rastliny, pp. 86-156. - In: Feráková V. & Kocianová E. (eds), Flóra, geológia a paleontológia Devínskej Kobyly. Litera, Bratislava.
CCDB · slov-fl — Trávníček B., 1997: 16. Pseudolysimachion (W. D. J. Koch) Opiz - Veronikovec, pp. 264-298. - In: Goliašová K. (ed.), Flóra Slovenska V/2. Veda, Bratislava.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · iapt
CCDB · fl-europaea — Graze, 1933
CCDB · fl-europaea — Fischer, 1969
CCDB · poland — Pogan E., Wcis?o H., Izmai?ow R., Przywara L. et al. 1982 b. Further studies in chromosome numbers of Polish Angiosperms. Part XVI. Acta Biol. Cracov. Ser. Bot. 24, 159-189.
CCDB · veronic — Further studies in chromosome numbers of Polish angiosperms. Part. XVI | Acta Biol. Cracov., Ser. Bot. | 24: 159-189 | 1982
CCDB · veronic — IOPB chromosome number reports LVI. | Taxon | 26: 257-274 | 1977
CCDB · veronic — IOPB chromosome number reports XXXVIII. | Taxon | 21: 495-500 | 1972
CCDB · veronic — Karyological study of the Slovak flora XII | Acta Fac. Rerum Nat. Univ. Comenianae, Bot. | 33: 57--62 | 1986
CCDB · veronic — Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka river in its middle reaches) | Bot. Zurn. | 67:778-787 | 1982
CCDB · veronic — | Karyotaxonomicky prehlad flory Slovenska, Veda Vydavatelsto Slovenskej Akademie vied, Bratislava | | 1987
CCDB · veronic — Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija | Evoljucija na cvetnite rastenija i florogenez | 1: 72-106 | 1978
CCDB · veronic — Index of chromosome numbers of Slovakian Flora Part 4 | Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica | 23: 1-23 | 1974
CCDB · veronic — Veronica | Flore Slovenska | 5/2: 277 | 1997
CCDB · veronic — Chromosome numbers of some plant species from the south of Siberia. II. | Bot. Zurn. | 62: 1034-1042 | 1977
CCDB · veronic — Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region | Bot. Zhurn. | 79(2): 135-139 | 1994
CCDB · veronic — Chisla khromosom nekotorych vidov flory Sibiri. | Sb. Novye Dannye o Fitogeografii Sibiri. | 215-220 | 1981
CCDB · veronic — Nouvelle contribution la cytologie du genre Veronica. | Bull. Soc. Neuchtel. Sci. Nat. | 76: 111-119 | 1953
CCDB · veronic — Numeri cromosomici per la Flora Italiana: 787-793 | Inform. Bot. Ital. | 12: 327-332 | 1980
CCDB · veronic — Chromosome numbers of some plant species in the eastern Arctic Jakutia | Bot. Zurn. SSSR | 62: 229-234 | 1977
CCDB · ipcn-api-dl — Yurtsev, B. A. & P. G. ZHUKOVA. 1982. Chromosome numbers of some plants of the northeastern Yakutia (the drainage of the Indigirka River in its middle reaches). Bot. Zhurn. 67 (6): 778–787. (In Russian).
CCDB · ipcn-api-dl — Stepanov, N. V. 1994. Chromosome numbers of some higher plants taxa of the flora of Krasnoyarsk region. Bot. Žhurn. (Moscow & Leningrad) 79(2): 135–139.
CCDB · ipcn-api-dl — Rostovtseva, T. S., I. M. Krasnoborov & S. A. Krasnikova. 1981. Chisla khromosom nekotorych vidov flory Sibiri. Sb. Novye Dannye o Fitogeografii Sibiri. 215–220.
CCDB · ipcn-api-dl — Micelli, P. & G. Monti. 1980. Numeri cromosomici per la Flora Italiana: 787-793. Inform. Bot. Ital. 12: 327–332.
CCDB · ipcn-api-dl — Váchová, M. & V. Feráková. 1986. Karyological study of the Slovak flora XII. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 33: 57–62.
CCDB · ipcn-api-dl — Travnicek. 2004. Karyo-taxonomic study of the genus Pseudolysimachion (Scrophulariaceae) in the Czech Republic and Slovakia. Folia Geobot. 39(2): 173–203.
CCDB · book-ipcn72 — PEEV, D. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 495-500.
CCDB · book-ipcn75-78 — Zhukova et al. 1977a
CCDB · book-ipcn75-78 — Rostovtseva 1977
CCDB · book-ipcn75-78 — Vachova 1974a
CCDB · book-ipcn75-78 — Kliphuis 1977
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.
CCDB · book-atlas-flowering-plants — Graze 1933
+7 more references
2n 369×CCDB · veronic · CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · veronic — Chromosome nubers in some species of the genus Veronica (Scrophulariaceae) in the Ukraine. | Bot. Zurn. | 73: 454-455 | 1988
CCDB · ipcn-api-dl — Androshchuk, A. F. 1988. Chromosome numbers in some species of the genus Veronica (Scrophulariaceae) in the Ukraine. Bot. Žhurn. (Moscow & Leningrad) 73: 454–455.
CCDB · CromoCat 2015 — Androshchuk, A. F. (1988). Chromosome numbers in some species of the genus Veronica (Scrophulariaceae) in the Ukraine Botani?eskij Žurnal (Moscow & Leningrad) 73: 454-455
2n 185×CCDB · veronic · CCDB · ipcn-api-dl
CCDB · veronic — Chromosome nubers in some species of the genus Veronica (Scrophulariaceae) in the Ukraine. | Bot. Zurn. | 73: 454-455 | 1988
CCDB · ipcn-api-dl — Androshchuk, A. F. 1988. Chromosome numbers in some species of the genus Veronica (Scrophulariaceae) in the Ukraine. Bot. Žhurn. (Moscow & Leningrad) 73: 454–455.
2n 562×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · CromoCat 2015 — Magulaev, A. Y. (1984). Cytotaxonomix study in some flowering plants of the North Caucasus. Bot. Žurn. 69: 511-517.
2n 321×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — ZHUKOVA, P.G., V.V. PETROVSKY, & T.N. PLIEVA. 1973. The chromosome numbers and taxonomy of some plant species from Siberia and Far East. (in Russian) Bot. zurn. (Moscow & Leningrad) 58: 1331-1342.
n 178×CCDB · veronic · CCDB · book-ipcn67-71
CCDB · veronic — Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion, Paederota, Wulfenia und Lagotis (Scrophulariaceaea-Veronicinae). | Oesterr. Bot. Zeits. | 116: 430-443 | 1969
CCDB · veronic — Nouvelle contribution la cytologie du genre Veronica. | Bull. Soc. Neuchtel. Sci. Nat. | 76: 111-119 | 1953
CCDB · veronic — Die chromosomalen Verhltnisse in der Sektion Pseudolysimachia Koch der Gattung Veronica. | Jahrb. Wissensch. Bot. | 77, 4: 507-559 | 1933
CCDB · book-ipcn67-71 — FISCHER, M. 1969. Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion Paederota, Wulfenia und Lagotis (scrophulariaceae-Veronicinae). oesterr. Bot. Zeits. 116: 430-443.
n 347×CCDB · veronic · CCDB · book-ipcn67-71
CCDB · veronic — Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion, Paederota, Wulfenia und Lagotis (Scrophulariaceaea-Veronicinae). | Oesterr. Bot. Zeits. | 116: 430-443 | 1969
CCDB · veronic — Die chromosomalen Verhltnisse in der Sektion Pseudolysimachia Koch der Gattung Veronica. | Jahrb. Wissensch. Bot. | 77, 4: 507-559 | 1933
CCDB · veronic — Taxonomic studies on Veronica longifolia and V. spicata in Eastern Fennoscandia. | Ann. Bot. Fenn. | 4: 471-485 | 1967
CCDB · book-ipcn67-71 — RAITANEN, P. R. 1967. Taxonomic studies on Veronica longifolia and y. spicata in Eastern Fennoscandia. Ann. Bot. Fenn. 4: 471-485
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelScaffold
08Occurrence & distribution
Record type42 093 records
Wild obs. + sensor35 988
Museum / vouchered5 642
Cultivated / captive7
Other456
Origin
Native144
Introduced55
Range
Area of Occupancy AOO58 804 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy72% within 1 km
≤100 m 16 337≤1 km 3 275≤10 km 6 988>10 km 619
27 219 georeferenced · 8 769 without coordinates
Open the mapobservation + sensor35 988
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 331≤1 km 925≤10 km 2 035>10 km 285
3 576 georeferenced · 2 066 without coordinates
Open the institutions mapphysical evidence5 642
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy20% within 1 km
≤100 m 1≤10 km 1>10 km 3
5 georeferenced · 2 without coordinates
Open the mapnot free-living7
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions65 of 145 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 374 |
| Moscow State Universitylocation not on record | 668 |
| LDlocation not on record | 435 |
| Olocation not on record | 266 |
| Uppsala, SE | 214 |
| Adam Mickiewicz University in Poznańlocation not on record | 204 |
| Tartu, EE | 172 |
| Oskarshamn, SE | 134 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 120 |
| SLU Artdatabankenlocation not on record | 114 |
| Turku, FI | 86 |
| Tallinn, EE | 76 |
| BRNUlocation not on record | 49 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 42 |
| Beijing, CN | 40 |
| Zürich, CH | 38 |
| Mlocation not on record | 37 |
| Urumqi, CN | 37 |
| Zürich, CH | 35 |
| Bergen, NO | 34 |
| TUR-Alocation not on record | 30 |
| Oulu, FI | 30 |
| Uniwersytet Śląski w Katowicachlocation not on record | 28 |
| Bern, CH | 27 |
| Trondheim, NO | 26 |
| Wlocation not on record | 22 |
| IB FRC Komi SC UB RASlocation not on record | 22 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 20 |
| Görlitz, DE | 18 |
| SWlocation not on record | 18 |
| TROMlocation not on record | 16 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 16 |
| Barcelona, ES | 16 |
| BDBClocation not on record | 14 |
| GJOlocation not on record | 13 |
| Urumqi, CN | 13 |
| Uniwersytet Warszawskilocation not on record | 11 |
| Jyväskylä, FI | 11 |
| Stadt Seeland, Ortsteil Gatersleben, DE | 11 |
| BFLlocation not on record | 11 |
| Salzburg, AT | 10 |
| Helsinki, FI | 9 |
| Stockholm, SE | 8 |
| KMNlocation not on record | 8 |
| Berlin, DE | 8 |
| Chongqing Museumlocation not on record | 8 |
| WNNUlocation not on record | 7 |
| South Kensington, GB | 7 |
| LfUlocation not on record | 7 |
| Porrentruy, CH | 7 |
| Dresden, DE | 7 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 7 |
| Kuopio, FI | 6 |
| Denver, US | 6 |
| PRClocation not on record | 6 |
| Tula State Universitylocation not on record | 5 |
| Nanjing, CN | 5 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 5 |
| MeiseBGlocation not on record | 5 |
| SZUlocation not on record | 5 |
| Philadelphia, US | 5 |
| Samara National Research Universitylocation not on record | 5 |
| BIO-UNIPIlocation not on record | 5 |
| Provincia di Livornolocation not on record | 5 |
| GZUlocation not on record | 5 |
| NMBU:MINAlocation not on record | 5 |
| Universität Göttingenlocation not on record | 5 |
| Bourges, FR | 4 |
| Winterthur, CH | 4 |
| Allentown, US | 4 |
| Sion, CH | 4 |
| No collectionlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Porvoo, FI | 4 |
| Uniwersytet Opolskilocation not on record | 3 |
| València, ES | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Frankfurt am Main | 3 |
| BClocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Paris, FR | 3 |
| Xining, CN | 3 |
| Podgorica, ME | 2 |
| Université Lavallocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| MAlocation not on record | 2 |
| Vitoria, ES | 2 |
| Tampa, US | 2 |
| Universidad de La Salle (La Salle)location not on record | 2 |
| Bloomington, US | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| BGBMlocation not on record | 2 |
| Herbarium of South China Botanical Gardenlocation not on record | 2 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Kew, GB | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Monastir, TN | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Inner Mongolia Universitylocation not on record | 1 |
| Davis, US | 1 |
| EL PASO, US | 1 |
| CICYTEXlocation not on record | 1 |
| Xian, CN | 1 |
| Chicago, US | 1 |
| nlocation not on record | 1 |
| Naturalis Biodiversity Centerlocation not on record | 1 |
| Toronto, CA | 1 |
| Badajoz, ES | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Karlsruhe, DE | 1 |
| Santa Barbara, US | 1 |
| Göteborg, SE | 1 |
| Wellington, NZ | 1 |
| SNSNMClocation not on record | 1 |
| DOI/NPS, Greenbelt Parklocation not on record | 1 |
| FLADlocation not on record | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| Pamplona, ES | 1 |
| Boumlocation not on record | 1 |
| POL003location not on record | 1 |
| Durham, US | 1 |
| Long Beach, US | 1 |
| Tromso University Museumlocation not on record | 1 |
| Whitehorse, CA | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Museum of the Rockieslocation not on record | 1 |
| Saint Louis, US | 1 |
| Wuzhou, CN | 1 |
| STUlocation not on record | 1 |
| Xiamen, CN | 1 |
| University of Trondheim, Museum of Natural History and Archeologylocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Tuscaloosa, US | 1 |
| San Sebastián, ES | 1 |
| University of New Hampshirelocation not on record | 1 |
| Bronx, US | 1 |
| Dekalb, US | 1 |
| nbflocation not on record | 1 |
145 institutions · 4 856 of 5 642 vouchered records shown · 675 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Veronica spicata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys2
Countries7
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map7 countries0
grassland
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median16.2 °C 12.0–20.2
Seasonal swing summer↔winter22.3 °C
Max temp (day)18.9 °C 14.3–25.3
Min temp (night)12.6 °C 8.60–15.1
Precipitation80.5 mm/mo 61.8–104
Air humidity59.9 % 56.9–62.8
Moisture balance-52.2 mm/mo -69.7–71.1
Vapour deficit696 Pa 529–1,015
Wind speed3.70 m/s 2.50–5.50
Cloud cover41.2 % 36.9–49.0
CHELSA 1981–2010, ~9 km grid, at location & month of 19 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.