Veronica serpyllifolia
speciesAt a glance
Occurrence records279 979
Data sources15
Biological traits68
DNA specimens79
eDNA detections35
Sources15 archives
Databases and archives Veronica serpyllifolia's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility279 979 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI35 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics79 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources68 traits
Chemical compositionLOTUS · NPASS6 compounds
Occurrence & distributionGBIF279 979 records
Environmental DNA2 datasets · 8 countries35 detections
DNA & barcodingBOLD · NCBI79 specimens
Genome at a glanceCCDB · GoaT · NCBI440 Mbp
01Narrative
La Véronique à feuilles de serpolet est une plante rampante basse, parfois adventice des jardins et des cultures, assez répandue dans toute l'Europe.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology25
Fruit length3.05 mm
⚠ sources differ — AusTraits: 3.05 mm · GIFT: 2.75 mm
Fruit length max3 mm
Fruit length min2.5 mm
Fruit width3.55 mm
⚠ sources differ — AusTraits: 3.55 mm · GIFT: 4.25 mm
Fruit width max5 mm
Fruit width min4 mm
Leaf length10 mm
⚠ sources differ — AusTraits: 10 mm · GIFT: 16.5 mm
Leaf length max25 mm
Leaf length min4 mm
Leaf mass8.02 mg
Leaf size51.67 mm²
⚠ sources differ — TRY: 51.67 mm² · LEDA: 188 mm² · GIFT: 188 mm²
Leaf width6.5 mm
⚠ sources differ — AusTraits: 6.5 mm · GIFT: 11 mm
Leaf width max15 mm
Leaf width min2 mm
Plant height0.181 m
⚠ sources differ — GIFT: 0.181 m · AusTraits: 0.1 m · LEDA: 0.125 m · TRY: 0.164 m
Plant height generative0.106 m
Plant height max0.3 m
Plant height min0.05 m
Seed length0.88 mm
⚠ sources differ — TRY: 0.88 mm · GIFT: 1 mm
Seed mass0.053 mg
⚠ sources differ — TRY: 0.053 mg · AusTraits: 0.054 mg · LEDA: 0.046 mg · GIFT: 0.049 mg
Seed mass max0.054 mg
Seed mass min0.04 mg
Seed volume0.04 mm³
Seed volume max0.04 mm³
Seed volume min0.04 mm³
Life cycle & reproduction18
Deciduousnessevergreen
Dispersal typeself
⚠ sources differ — AusTraits: barochory · LEDA: endozoochor · GIFT: hydrochorous
Flower colourblue
Flower width max6 mm
Flower width min5 mm
Flowering endAug
Flowering startApr
Flowering timeyynnnnnnnyyy
Life formsubshrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Resprouting capacityresprouts
Seed number1 021
Self fertilizationpresent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max4 500 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typecapsule
Growth formherb
Habitat GIFTÁrea Antrópica
Leaf compoundnesssimple
Leaf formovate
Leaf shapewidely_elliptical
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry5
Leaf dry-matter content (LDMC)175 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)5.33 mm²/mg
⚠ sources differ — TRY: 5.33 mm²/mg · LEDA: 22.8 mm²/mg · GIFT: 22.86 mm²/mg
Other traits3
Diaspore typegenerative dispersule
Seeds per fruit101-1000
Shoot orientationascending
03Chemical composition6 compounds
Compounds documented for Veronica serpyllifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile3 classes
Dammarane and Protostane triterpenoids $ Lupane triterpenoids2
Iridoids monoterpenoids1
Dammarane and Protostane triterpenoids1
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,2S,5R,6R,7R,11S,14R,15R,18R,20S)-20-hydroxy-11,14,15,19,19-pentamethyl-7-prop-1-en-2-yl-8,21-dioxahexacyclo[18.2.2.01,18.02,15.05,14.06,11]tetracosan-9-one | present | NPASS | |
| Aucubin | present | LOTUS | |
| JSPGKOBNHWTKNT-PJSNPGDSSA-N | present | NPASS | |
| Lippiolic Acid | present | NPASS | |
| Lippiolidolic acid | present | NPASS | |
| SXPWHBXTTWFWMH-BIRDSZKRSA-N | present | NPASS |
05DNA & barcoding79 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica serpyllifolia has left across the world's sequence archives.
At a glance
DNA specimens79
Marker genes10
GenBank sequences10
eDNA detections35
Countries10
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCTTCTGGCCGAGGGCACGTCTGCCTGGGCGTCACGCATC …
Veronica serpyllifolia voucher EDNA21-0061104 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK5★rbcL★rbcLa★trnL-F★ITS5★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Veronica serpyllifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size440 100 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Veronica serpyllifolia0.44 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 14 n = 7
Ploidy2× diploid · measured
Chromosome records14–482n range14median14mode129records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 14119×GoaT · Kew Plant DNA C-values Database · CCDB · ita-fl · CCDB · slov-fl +19
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ita-fl — GADELLA T.W.J., KLIPHUIS E. - 1970. Chromosome studies in some flowering plants collected in the French Alps (haute Savoie).. Rev. Gn. Bot. , 77: 487-497.
CCDB · ita-fl — RAIMONDO F.M., ROSSITTO M., OTTONELLO D. - 1984 (1983). Numeri cromosomici per la flora italiana:967-976.. Inform. Bot. Ital. , 15(1): 58-65.
CCDB · slov-fl — Májovský J. et al., 1970b: Index of chromosome numbers of Slovakian flora Part 2. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 18: 45-60.
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · brit-fl — Hollingsworth, P.M., Gornall, R.J., Bailey, J.P. Watsonia 19: 134-137 (1992)
CCDB · brit-fl — Bailey, J.P., Gornall, R.J. Irish Naturalists' J. : ()
CCDB · brit-fl — Dempsey, R.E., Gornall, R.J., Bailey, J.P. Watsonia 20: 63-66 (1994)
CCDB · iber-fl — Contribution la connaissance cytotaxinomique des spermatophyta du Portugal. Fernandes, A., M. Queirs & M. F. Santos.Bol. Soc. Brot. ser. 251: 37-90(1977).
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3624
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=3625
CCDB · fl-europaea — Ldve & LoVe, 1956
CCDB · fl-europaea — Rutland, 1941
CCDB · poland — Skali?ska M., Pogan E., Jankun A. et al. 1968. Further studies in chromosome numbers of Polish Angiosperms. Seventh contribution. Acta Biol. Cracov. Ser. Bot. 11, 199-224.
CCDB · veronic — Cytotaxonomic studies in Veronica and related genera. | Ann. Rept. Natl. Inst. Genet. (Japan) | 9: 54 | 1959
CCDB · veronic — Khromosomnye chisla nekotorykh vidov flory Belorussii. | Izv. Akad. Nauk Belorussk. SSR, ser. Biol. Nauk (Minsk) | 2: 7-12 | 1983
CCDB · veronic — Flora of the Queen Charlotte Islands. Part 2. Cytological aspects of the Vascular Plants. | Queen's Printer, Ottawa | page 148 | 1968
CCDB · veronic — Chromosome numbers of flowering plants in the Netherlands II. | Proc. Kon. Ned. Acad. Wetensch. ser C | 69: 541-556 | 1966
CCDB · veronic — Chromosome studies in some flowering plants colleted in the French Alps (Haute Savoie) | Rev. Gen. Bot. | 77: 487-497 | 1970
CCDB · veronic — Studies in chromosome numbers of Yugoslavian angiosperms | Acta Bot. Croatica | 31: 91-103 | 1972
CCDB · veronic — Recherche sur l'origine de la flore orophile du Maroc: tude caryologique et cytogographique | Trav. Inst. Sci. Univ. Mohammed V. Sr. Bot. (Rabat) | 35: 1-168 | 1988
CCDB · veronic — Chromosome numbers in South Swedish vascular plants | Opera Botanica | 137: 1-42 | 1999
CCDB · veronic — Cytotaxonomy of Spanish plants. IV. Dicotyledons: Caesalpiniaceae-Asteraceae. | Lagascalia | 4: 153-211 | 1974
CCDB · veronic — Die Chromosomenzahlen der Gefpflanzen Mitteleuropas | | | 1950
CCDB · veronic — Taxonomy of Veronica subsect. Serpyllifolia (Scrophulariaceae) | Bot. J. Linn. Soc. | 135: 179-194 | 2001
CCDB · veronic — Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part. II. | Ber. Schweiz. Bot. Ges. | 85: 210-252 | 1975
CCDB · veronic — Chromosome numbers of vascular plants from the various regions of the USSR | Bot. Zurn. | 75: 1783-1786 | 1990
CCDB · veronic — Hromosomnye cisla vidov roda Veronica (Scrophulariaceae) v Belorussii | Bot. Zurn. | 86/8: 144-147 | 2001
CCDB · veronic — Contributions to a cytological catalogue of the British and Irish flora. 4. | Watsonia | 20: 63-66 | 1994
CCDB · veronic — Contribution to a cytological catalogue of the British and Irish flora, 2. | Watsonia | 19: 134-137 | 1992
CCDB · veronic — IOPB Chromosome number reports LXXIII. | Taxon | 30: 829-861. | 1981
CCDB · veronic — Chromosome counts of vascular plants of the island Seili in Nauvo, SW Finland. (In Finnsh). | Turun Yliopiston Biologian-Laitoksen Julkaisuja | 3: 1-12 | 1982
CCDB · veronic — IOPB chromosome number reports LXXXVI. | Taxon | 31: 589-592 | 1982
CCDB · veronic — Veronica | in Strid, A. & Kit Tan, Mountain Flora of Greece | 2: 209-234 | 1991
CCDB · veronic — Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija | Evoljucija na cvetnite rastenija i florogenez | 1: 72-106 | 1978
CCDB · veronic — Nouvelle contribution l'tude caryologique des endmiques de la Corse | Bull. Soc. Bot. France | 104: 533-538 | 1957
CCDB · veronic — Veronica | Flora Iranica | 147:52-165 | 1981
CCDB · veronic — Index of chromosome numbers or Slovakian flora Part 2 | Acta Facultatis Rerum Naturalium Universitatis Comenianae, Botanica | 18: 45-60 | 1970
CCDB · veronic — Geographical distribution on polyploid species (investigation of flora of Kamchatka) | Vestnik. Leningr. Univ., ser. Biol. | 1963, 3:38-52 | 1963
CCDB · veronic — The kariological characteristics of flora representatives of the Leningrad region | Vestn. Leningr. Univ., ser. Biol. | 1972, 21: 56-63 | 1972
+61 more references
2n 286×CCDB · veronic · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · veronic — Die Chromosomenzahlen der Gefpflanzen Mitteleuropas | | | 1950
CCDB · veronic — Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo Biosfernogo Zapovednika. | Zapov. Belorussii Issl. | 12: 3-8 | 1988
CCDB · veronic — Genus Veronica in Bulgaria -some new taxa and chromosome numbers. | Phytology (Sofia) | 2: 42-56 | 1975
CCDB · book-ipcn75-78 — Peev 1975
CCDB · CromoCat 2015 — Parfenov, V. I. & S. A. Dmitrieva. (1988a). Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfernogo zapovednika.
Kariologicheskaja kharakteristika predstavitelej flory sosudistykh rastenij Berezinskogo biosfe
CCDB · CromoCat 2015 — Tischler, G. (1950). Die chromosomenzhalen der GefäBpflanzen Mitteleuropas. s'-Gravenhage: W. Junk. 263
2n 162×CCDB · veronic · CCDB · ipcn-api-dl
CCDB · veronic — Chromosome numbers in some representatives of the familes Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariacae, Solanaceae, Urticaceae from the Soviet Far East. | Bot. Zurn. | 75: 1619-1622 | 1990
CCDB · ipcn-api-dl — Probatova, N. S. & A. P. Sokolovskaya. 1990. Chromosome numbers in some representatives of the families Asclepiadaceae, Asteraceae, Boraginaceae, Chenopodiaceae, Lamiaceae, Oleaceae, Onagraceae, Scrophulariaceae, Solanaceae, Urticaceae from the Soviet Far East. Bot. Žhurn. (Moscow & Leningrad) 75: 1619–1622.
2n 482×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Peev, D. (1975a). Genus Veronica in Bulgaria some new taxa and chromosome numbers. Fitologija 2: 42-46.
CCDB · CromoCat 2015 — Peev, D. (1978). Taxonomija i microevoljucija na divorastjastite predstaviteli na rod Veronica L. (velikdence) v Balgarija. In: Evoljuclja na cvetnite rastenija i florogenez 1: 106.
n 725×CCDB · veronic · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +1
CCDB · veronic — IOPB Chromosome data 13 | Int. Organ. Pl. Biosyst. Newslett. | 29: 18-22 | 1998
CCDB · veronic — Chromosome numbers of some plants native and naturalized in Canada. | Naturaliste Canad. | 111: 447-449 | 1984
CCDB · veronic — Chromosome numbers of some North American Scrophulariaceae, mostly Californian. | Madroo | 39: 137-149 | 1992
CCDB · veronic — Contribution to the cytotaxonomy and cytogeography of the flora of the western Himalayas (with an attempt to compare it with the flora of the Alps). Part. II. | Ber. Schweiz. Bot. Ges. | 85: 210-252 | 1975
CCDB · veronic — Chromosome numbers in vascular plants from Finland. | | 130: 1-37 | 1985
CCDB · veronic — Contribution l'tude caryologique et gntique des Veronica. | Compt. Rend. Soc. Biol. (Paris) | 117, 36: 1153-1156 | 1934
CCDB · veronic — Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion, Paederota, Wulfenia und Lagotis (Scrophulariaceaea-Veronicinae). | Oesterr. Bot. Zeits. | 116: 430-443 | 1969
CCDB · veronic — Polyploidy in the flora of Pakistan - an analytical study | Ph.D. thesis, Dept. of Botany, Univ. of Karachi, Pakistan | | 1991
CCDB · veronic — Observations on chromosomes of some plants from western Sichuan. | Cathaya | 2: 191-197 | 1990
CCDB · ipcn-api-dl — Mulligan, G. A. 1984. Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447–449.
CCDB · ipcn-api-dl — Hong, D. y. & S. z. Zhang. 1990. Observations on chromosomes of some plants from western Sichuan. Cathaya 2: 191–197.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
CCDB · ipcn-api-dl — Chambers, K. L., D. Green, S. Potampa & L. McMahan. 1998. IOPB chromosome data 13. Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18–22.
CCDB · book-ipcn75-78 — Vasudevan 1975
CCDB · CromoCat 2015 — Fischer, M. (1969). Einige Chromosomenzahlen aus den Gattungen Veronica, Pseudolysimachion Paederota, Wulfenia und Lagotis (Scrophulariaceae-Veronicinae). Österr. Bot. Z. 116: 430-443.
CCDB · CromoCat 2015 — Hong, D.-y. & Zhang, S.-z. (1990). Observations on chromosomes of some plants from western Sichuan
Observations on chromosomes of some plants from western Sichuan. Cathaya 2: 191-197.
CCDB · CromoCat 2015 — Khatoon, S. & Ali, S. I. (1993). Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi
CCDB · CromoCat 2015 — Mulligan, G. A. (1984). Chromosome numbers of some plants native and naturalized in Canada. Naturaliste Canad. 111: 447-449.
CCDB · CromoCat 2015 — Kenton, L., Ch., Green, D., Potampa, S. & McMahan, L. (1998). IOPB Chromosome Data 13 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 29: 18-22.
CCDB · CromoCat 2015 — Chuang, T. I. & Heckard, L. R. (1992). Chromosome numbers of some North American Scrophulariaceae, mostly Californian. Madroño 39:137-149
CCDB · CromoCat 2015 — Chambers, K. L., Green, D., Potampa, S. & McMahan, L. (1998). IOPB chromosome data 13 Newslett. Int. Organ. Pl. Biosyst. (Oslo) 29: 18-22
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.999 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness96% BUSCO
08Occurrence & distribution
Record type279 979 records
Wild obs. + sensor268 636
Museum / vouchered10 419
Cultivated / captive328
Other596
Origin
Native28 738
Introduced133
Range
Area of Occupancy AOO442 420 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy47% within 1 km
≤100 m 55 662≤1 km 58 161≤10 km 127 392>10 km 2 245
243 460 georeferenced · 25 176 without coordinates
Open the mapobservation + sensor268 636
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy44% within 1 km
≤100 m 604≤1 km 1 882≤10 km 2 747>10 km 411
5 644 georeferenced · 4 775 without coordinates
Open the institutions mapphysical evidence10 419
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy8% within 1 km
≤100 m 1>10 km 11
12 georeferenced · 316 without coordinates
Open the mapnot free-living328
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions211 of 363 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 1 042 |
| Olocation not on record | 403 |
| Moscow State Universitylocation not on record | 300 |
| BIO-UNIPIlocation not on record | 297 |
| LDlocation not on record | 289 |
| Salzburg, AT | 247 |
| BRNUlocation not on record | 237 |
| Philadelphia, US | 200 |
| Uppsala, SE | 198 |
| Beijing, CN | 198 |
| Chongqing Museumlocation not on record | 179 |
| MeiseBGlocation not on record | 175 |
| Chicago, US | 163 |
| Tartu, EE | 160 |
| TROMlocation not on record | 157 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 151 |
| Québec, CA | 133 |
| Bergen, NO | 129 |
| Oregon State Universitylocation not on record | 119 |
| Garðabær, IS | 111 |
| Chengdu, CN | 110 |
| Kunming, CN | 96 |
| Oskarshamn, SE | 92 |
| Adam Mickiewicz University in Poznańlocation not on record | 80 |
| Yangling, CN | 77 |
| Castelar, AR | 77 |
| Oulu, FI | 75 |
| Turku, FI | 74 |
| Jyväskylä, FI | 73 |
| Ann Arbor, US | 71 |
| SLU Artdatabankenlocation not on record | 65 |
| KMNlocation not on record | 64 |
| Museo Entomologico de Leonlocation not on record | 64 |
| Acadia Universitylocation not on record | 62 |
| Saint Louis, US | 62 |
| Christchurch, NZ | 61 |
| Angwin, US | 56 |
| Mount Annan, AU | 55 |
| Moscow, US | 55 |
| Provincia di Livornolocation not on record | 54 |
| Wlocation not on record | 53 |
| Bronx, US | 53 |
| Görlitz, DE | 52 |
| Tallinn, EE | 49 |
| TUR-Alocation not on record | 48 |
| Auckland, NZ | 48 |
| Hobart, AU | 47 |
| WTUlocation not on record | 47 |
| Toronto, CA | 46 |
| Wellington, NZ | 45 |
| University of New Hampshirelocation not on record | 44 |
| BFLlocation not on record | 42 |
| Wuhan, CN | 42 |
| South Kensington, GB | 42 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 42 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 41 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 41 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 41 |
| Vitoria, ES | 41 |
| Berlin, DE | 39 |
| 38 | |
| Canberra, AU | 38 |
| National Biodiversity Institute, Costa Ricalocation not on record | 37 |
| Saint John, CA | 37 |
| Université Lavallocation not on record | 37 |
| Green Bay, US | 37 |
| Madison, US | 36 |
| Guangzhou, CN | 36 |
| St. Paul, US | 36 |
| Trondheim, NO | 36 |
| Nanjing, CN | 33 |
| Uniwersytet Warszawskilocation not on record | 33 |
| New Haven, US | 33 |
| University of Stellenboschlocation not on record | 32 |
| Salamanca, ES | 31 |
| Kew, GB | 31 |
| University of Wisconsinlocation not on record | 31 |
| València, ES | 29 |
| Chengdu, CN | 29 |
| MAlocation not on record | 29 |
| San Sebastián, ES | 28 |
| Lanzhou, CN | 28 |
| College Park, US | 27 |
| Victoria, CA | 26 |
| GJOlocation not on record | 25 |
| Barcelona, ES | 24 |
| Montréal, CA | 24 |
| Albuquerque, US | 24 |
| Flagstaff, US | 23 |
| BDBClocation not on record | 23 |
| Pullman, US | 22 |
| Zürich, CH | 22 |
| Frankfurt am Main | 22 |
| Boise, US | 21 |
| Williamsburg, US | 21 |
| Uniwersytet Śląski w Katowicachlocation not on record | 19 |
| Logan, US | 19 |
| Cambridge, US | 19 |
| Zürich, CH | 19 |
| Allentown, US | 18 |
| Durango, MX | 18 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 17 |
| Helsinki, FI | 17 |
| Aarhus, DK | 16 |
| Dresden, DE | 15 |
| Xiamen, CN | 15 |
| Corvallis, US | 15 |
| Mlocation not on record | 14 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 14 |
| Porrentruy, CH | 13 |
| Entomological Society of Latvialocation not on record | 13 |
| Bangkok, TH | 13 |
| Dekalb, US | 13 |
| Kuopio, FI | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| McWane Science Centerlocation not on record | 12 |
| Arcata, US | 12 |
| Universidad de Antioquia (UdeA)location not on record | 12 |
| Brisbane, AU | 12 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 11 |
| Paris, FR | 11 |
| Bozeman, US | 11 |
| SZUlocation not on record | 11 |
| Keene State Universitylocation not on record | 11 |
| Vancouver, CA | 10 |
| Glarus, CH | 10 |
| ASUlocation not on record | 10 |
| Knoxville, US | 10 |
| Odawara, JP | 10 |
| DBF-NHMDlocation not on record | 10 |
| La Paz, BO | 9 |
| University of Lethbridgelocation not on record | 9 |
| Portland, US | 9 |
| Bloomington, US | 9 |
| CICYTEXlocation not on record | 9 |
| Staten Island, US | 9 |
| University of Alberta Museumslocation not on record | 9 |
| Millersville, US | 9 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 8 |
| Chapel Hill, US | 8 |
| Seoul, KR | 8 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 8 |
| New Brunswick, US | 7 |
| Pocatello, US | 7 |
| Adelaide, AU | 7 |
| Austin, US | 7 |
| BISHlocation not on record | 7 |
| BClocation not on record | 7 |
| Johnson City, US | 7 |
| Armidale, AU | 7 |
| Tacoma, US | 7 |
| Wuzhou, CN | 7 |
| Denver, US | 7 |
| Jardín Botánico de Bogotá José Celestino Mutis (JBB)location not on record | 6 |
| PRClocation not on record | 6 |
| WNNUlocation not on record | 6 |
| Parkville, AU | 6 |
| Museum of the Rockieslocation not on record | 6 |
| Stockholm, SE | 6 |
| Claremont, US | 6 |
| Honolulu, US | 6 |
| San Isidro, AR | 6 |
| Karlsruhe, DE | 6 |
| Tilburg, NL | 6 |
| Fredericton Stock Culture Collectionlocation not on record | 6 |
| NMBU:MINAlocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 5 |
| AASlocation not on record | 5 |
| Bourges, FR | 5 |
| UChlocation not on record | 5 |
| Kandalaksha State Nature Reservelocation not on record | 5 |
| nbflocation not on record | 5 |
| Xining, CN | 5 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 5 |
| Orem, US | 5 |
| Riverside, US | 5 |
| Herb. BBGlocation not on record | 5 |
| Davis, US | 5 |
| San Diego, US | 5 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 5 |
| Durham, US | 5 |
| Provo, US | 5 |
| CJBGlocation not on record | 5 |
| QVMAGlocation not on record | 5 |
| Oswego, US | 5 |
| Bend, US | 4 |
| Fulda, DE | 4 |
| National Museum Waleslocation not on record | 4 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 4 |
| Washington, US | 4 |
| Blumenau, BR | 4 |
| Caldwell, US | 4 |
| Guilin, CN | 4 |
| Mexico City, MX | 4 |
| Universidad de La Salle (La Salle)location not on record | 4 |
| Phoenix, US | 4 |
| Whitewater, US | 3 |
| Yunnan Universitylocation not on record | 3 |
| Columbia, US | 3 |
| Anchorage, US | 3 |
| University of Trondheim, Museum of Natural History and Archeologylocation not on record | 3 |
| Rocky Mountain Biological Laboratorylocation not on record | 3 |
| Cambridge, US | 3 |
| Ypsilanti, US | 3 |
| Truckee, US | 3 |
| Weber State Universitylocation not on record | 3 |
| Göteborg, SE | 3 |
| Cochabamba, BO | 3 |
| Pittsburg, US | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Rovaniemi, FI | 3 |
| Long Beach, US | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Nijmegen, NL | 3 |
| Fargo, US | 3 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 3 |
| Xian, CN | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Musée des Confluenceslocation not on record | 3 |
| Chicago, US | 3 |
| Whitehorse, CA | 3 |
| Grand Junction, US | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| University of Hulllocation not on record | 3 |
| *unvoucheredlocation not on record | 3 |
| Taipei, TW | 3 |
| Davenport, US | 3 |
| Chicago, US | 2 |
| Missoula, US | 2 |
| Guiyang, CN | 2 |
| Cusco, PE | 2 |
| San Francisco, US | 2 |
| Tromso University Museumlocation not on record | 2 |
| Palmerston North, NZ | 2 |
| Wuhan, CN | 2 |
| Xian, CN | 2 |
| Philadelphia, US | 2 |
| University of Tennessee at Chattanoogalocation not on record | 2 |
| Dhaka, BD | 2 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 2 |
| PTHlocation not on record | 2 |
| Tianjin Natural History Museumlocation not on record | 2 |
| Fairfax, US | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Cheney, US | 2 |
| Akita Prefectural Museumlocation not on record | 2 |
| Burlington, US | 2 |
| OLAlocation not on record | 2 |
| San Angelo, US | 2 |
| College of the Atlantic, Museumlocation not on record | 2 |
| Northridge, US | 2 |
| Sant Julià de Lòria, AD | 2 |
| MERFlocation not on record | 2 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 2 |
| Brooklyn Botanic Gardenlocation not on record | 2 |
| KURAlocation not on record | 2 |
| Universidad de Caldas (UCaldas)location not on record | 2 |
| Podgorica, ME | 2 |
| Valparaiso, CL | 2 |
| BAYLUlocation not on record | 2 |
| San José, CR | 2 |
| Porvoo, FI | 2 |
| Quito, EC | 2 |
| Mendoza, AR | 2 |
| Mohonk Preservelocation not on record | 2 |
| DASSHlocation not on record | 2 |
| Herbario Universidad de Concepciónlocation not on record | 2 |
| Canadian Department of Agriculturelocation not on record | 2 |
| GZUlocation not on record | 2 |
| Gijón, ES | 2 |
| Cambridge, US | 2 |
| Black Rock Forest Consortiumlocation not on record | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Mexico City, MX | 2 |
| Granada, ES | 2 |
| Universiti Sains Malaysialocation not on record | 2 |
| Chongqing, CN | 1 |
| Urumqi, CN | 1 |
| La Paz, MX | 1 |
| AUAlocation not on record | 1 |
| Jackson, US | 1 |
| Memorial University of Newfoundlandlocation not on record | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Córdoba, AR | 1 |
| Muséum Henri Lecoqlocation not on record | 1 |
| Montréal, CA | 1 |
| Monastir, TN | 1 |
| USP-IBlocation not on record | 1 |
| Sion, CH | 1 |
| G. Peyrelocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Tampa, US | 1 |
| Jardín Botánico José Celestino Mutis (JBBJCM)location not on record | 1 |
| Ciudad de México, MX | 1 |
| Namur, BE | 1 |
| Waverly, US | 1 |
| Santa Cruz de la Sierra, BO | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| Santa Cruz, US | 1 |
| HJAEFlocation not on record | 1 |
| Universität Göttingenlocation not on record | 1 |
| Santa Barbara, US | 1 |
| Tuscaloosa, US | 1 |
| DOI/NPS, Mount Rainier National Parklocation not on record | 1 |
| East Lansing, US | 1 |
| Banyoles, ES | 1 |
| Institute of the biological problems of the North FEB RASlocation not on record | 1 |
| Ensenada, MX | 1 |
| IWEP FEB RASlocation not on record | 1 |
| H-AkrKGlocation not on record | 1 |
| COLlocation not on record | 1 |
| GAlocation not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| San Luis Obispo, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Chadron, US | 1 |
| Madrid, ES | 1 |
| Ivano-Frankove, UA | 1 |
| GMBAlocation not on record | 1 |
| Omachi Alpine Museumlocation not on record | 1 |
| H-Schuhwlocation not on record | 1 |
| Badajoz, ES | 1 |
| CASlocation not on record | 1 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 1 |
| North Carolina Museum of Natural Scienceslocation not on record | 1 |
| Fredericksburg, US | 1 |
| Sevilla, ES | 1 |
| HUAlocation not on record | 1 |
| Trois-Rivières, CA | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Asheville, US | 1 |
| Uniwersytet w Białymstokulocation not on record | 1 |
| US | 1 |
| Changsha, CN | 1 |
| Tomioka, JP | 1 |
| Universidad de Pamplona (UPamplona)location not on record | 1 |
| Corrientes, AR | 1 |
| Los Angeles, US | 1 |
| Philadelphia, US | 1 |
| Chongqing Natural History Museumlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| GB | 1 |
| Norfolk, US | 1 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 1 |
| Pelotas, BR | 1 |
| Beijing Normal Universitylocation not on record | 1 |
| ENTClocation not on record | 1 |
| Kingston, US | 1 |
| Richmond, US | 1 |
| Cenit Transporte y Logística de Hidrocarburos S.A.S. (CENIT)location not on record | 1 |
| LUXEMBOURG, LU | 1 |
| CJBNlocation not on record | 1 |
| FLADlocation not on record | 1 |
| Winterthur, CH | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Edinburgh, GB | 1 |
| BGBMlocation not on record | 1 |
363 institutions · 9 406 of 10 419 vouchered records shown · 922 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA35 detections
Where the DNA of Veronica serpyllifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found35
Studies independent surveys2
Countries8
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 35 detections have coordinates
Open the map8 countries0
next to path in conifer/semi-natural woodMesic grasslandPalearctic
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median13.2 °C 9.70–17.1
Seasonal swing summer↔winter18.4 °C
Max temp (day)16.4 °C 11.7–21.0
Min temp (night)9.50 °C 4.50–13.5
Precipitation77.6 mm/mo 44.3–126
Air humidity61.9 % 56.9–66.0
Moisture balance-32.0 mm/mo -54.1–44.3
Vapour deficit586 Pa 384–804
Wind speed3.40 m/s 2.40–4.70
Cloud cover47.0 % 40.2–63.0
CHELSA 1981–2010, ~9 km grid, at location & month of 31 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.