Veronica salicifolia

G.Forst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records4 332

Data sources13

Biological traits35

DNA specimens6

eDNA detections6

Sources13 archives

Databases and archives Veronica salicifolia's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility4 332 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources35 traits

Chemical compositionLOTUS3 compounds

Occurrence & distributionGBIF4 332 records

Environmental DNA1 datasets · 3 countries6 detections

DNA & barcodingBOLD · NCBI6 specimens

Genome at a glanceCCDB · GoaT1 Gbp

01Narrative

Hebe salicifolia, the koromiko, or willow-leaf hebe, is a flowering plant in the family Plantaginaceae, which is found throughout the South Island of New Zealand and in Chile. It is a large, evergreen shrub, reaching 2 m in height, with light green, spear-shaped leaves that are up to 12 cm long, and flowers that are white or pale lilac.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesGIFTLEDATRYWCVP

Size & morphology15

Fruit length4 mm

Fruit width3 mm

Leaf length max100 mm

Leaf size3 162 mm²

Leaf width18 mm

Leaf width max18 mm

Leaf width min18 mm

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · LEDA: 2.5 m · TRY: 2 m

Plant height max5 m

Seed length0.8 mm

Seed length max0.8 mm

Seed length min0.8 mm

Seed mass0.05 mg

Seed mass max0.05 mg

Seed mass min0.05 mg

Life cycle & reproduction8

Deciduousnessevergreen

Dispersal typehuman

⚠ sources differ — LEDA: agochor · GIFT: unspecialized

Life formshrub

Life spanperennial

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Elevation max2 760 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTLowland

Woodinesswoody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

03Chemical composition3 compounds

Compounds documented for Veronica salicifolia across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Iridoids monoterpenoids2

Cinnamic acids and derivatives $ Phenylethanoids1

Documented compounds3 total

Tissue Source Quantified only

Compound	Amount	Source
(1aS,1bS,2S,5aR,6S,6aS)-1a,1b,2,5a,6,6a-Hexahydro-6-hydroxy-1a-(hydroxymethyl)oxireno[4,5]cyclopenta[1,2-c]pyran-2-yl-beta-D-glucopyranoside	present	LOTUS
2-(Hexopyranosyloxy)-1a-(hydroxymethyl)-1a,1b,2,5a,6,6a-hexahydrooxireno[2',3':4,5]cyclopenta[1,2-c]pyran-6-yl 3,4-dihydroxybenzoate	present	LOTUS
[6-[2-(3,4-Dihydroxyphenyl)ethoxy]-2-(hydroxymethyl)-4-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxy-5-(3,4,5-trihydroxyoxan-2-yl)oxyoxan-3-yl] 3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica salicifolia has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes3

GenBank sequences7

eDNA detections6

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKJ630657.1 ↗619 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGTAAATCGAACCGCGAACACTGTCCATGAATTCGCCCGCTAGACGTCGC …

Veronica salicifolia voucher WELT SP082681 Bayly & Kellow MJB1600 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL4★ITS3★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Veronica salicifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size1 026 900 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Veronica salicifolia1.03 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 40 n = 20

Ploidypolyploid inferred

Chromosome records40–402n range40median40mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 409×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · veronic +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 35. Miscellaneous families | New Zealand J. Bot. | 37: 511-521 | 1999

CCDB · veronic — Studies on the cytology, genetics and taxonomy of New Zealand Hebe and Veronica (Part I). | New Zealand Jour. Sci. and Technol. | 18: 669-687 | 1937

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · ipcn-api-dl — Murray, B. G. & P. J. d. Lange. 1999. Contributions to a chromosome atlas of the New Zealand flora---35. Miscellaneous families. New Zealand J. Bot. 37: 511–521.

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

CCDB · book-atlas-flowering-plants — Frankel & H. 1937

n 209×CCDB · veronic · CCDB · book-ipcn67-71

CCDB · veronic — | New Zealand Hebes, an illustrated guide | | 2006, in press

CCDB · veronic — Contribution l'tude caryologique et gntique des Veronica. | Compt. Rend. Soc. Biol. (Paris) | 117, 36: 1153-1156 | 1934

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · book-ipcn67-71 — HAIR, J. B. 1967. Contributions to a chromosome atlas of the New Zealand flora - 10. Hebe (Scrophulariaceael. N. z. Jour. Bot. 5: 322-3 52.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type4 332 records

Wild obs. + sensor3 919

Museum / vouchered413

Origin

Native1

Introduced274

Range

Area of Occupancy AOO9 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 2 458≤1 km 490≤10 km 523>10 km 40

3 511 georeferenced · 408 without coordinates

Open the mapobservation + sensor3 919

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 1≤1 km 6≤10 km 10>10 km 15

32 georeferenced · 381 without coordinates

Open the institutions mapphysical evidence413

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 17 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	227
Wellington, NZ	135
Museo Entomologico de Leonlocation not on record	14
Hobart, AU	7
Chicago, US	5
Palmerston North, NZ	5
Edinburgh, GB	3
Moscow State Universitylocation not on record	2
Universidad de Caldas (UCaldas)location not on record	1
BSBIlocation not on record	1
Brisbane, AU	1
Mount Annan, AU	1
Pullman, US	1
Universidad de La Salle (La Salle)location not on record	1
Rotorua, NZ	1
South Kensington, GB	1
La Trobe Universitylocation not on record	1

17 institutions · 407 of 413 vouchered records shown · 2 without an institution code

09Environmental DNA6 detections

Where the DNA of Veronica salicifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median8.40 °C 5.70–14.1

Seasonal swing summer↔winter12.3 °C

Max temp (day)11.1 °C 9.20–20.5

Min temp (night)6.40 °C 1.40–8.70

Precipitation145 mm/mo 130–161

Air humidity58.8 % 54.8–62.6

Moisture balance54.3 mm/mo 39.0–65.1

Vapour deficit524 Pa 357–702

Wind speed3.50 m/s 2.50–5.90

Cloud cover20.8 % 19.0–38.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Veronica salicifolia

At a glance

Sources13 archives

Size & morphology15

Life cycle & reproduction8

Diet & foraging1

Habitat & environment9

Physiology & chemistry2

Compound class profile2 classes

Documented compounds3 total

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type4 332 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 17 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type4 332 records