Veronica pulvinaris

(Hook.fil.) Cheeseman · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records493

Data sources9

Biological traits6

DNA specimens2

eDNA detections2

Sources9 archives

Databases and archives Veronica pulvinaris's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility493 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources6 traits

Chemical compositionLOTUS14 compounds

Occurrence & distributionGBIF493 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 42

01Narrative

Veronica pulvinaris là một loài thực vật có hoa trong họ Mã đề. Loài này được (Hook.f.) Cheeseman miêu tả khoa học đầu tiên năm 1906.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Size & morphology1

Seed mass0.109 mg

Life cycle & reproduction1

Life formsubshrub

Habitat & environment2

Climatesubalpine or subarctic

Growth formherb

Physiology & chemistry2

Leaf n8.43 mg/g

Leaf p0.712 mg/g

03Chemical composition14 compounds

Compounds documented for Veronica pulvinaris across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile3 classes

Iridoids monoterpenoids9

Cinnamic acids and derivatives $ Phenylethanoids4

Cinnamic acids and derivatives1

Documented compounds14 total

Tissue Source Quantified only

Compound	Amount	Source
6-O-trans-Feruloylcatalpol	present	LOTUS
[(2R,3R,4S,5R,6R)-3-hydroxy-6-[2-(3-hydroxy-4-methoxyphenyl)ethoxy]-4,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-2-yl]methyl (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3R,4S,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-2-(hydroxymethyl)-4,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-3-yl] (E)-3-(3,4-dihydroxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3R,4S,5R,6R)-6-[2-(3,4-dihydroxyphenyl)ethoxy]-2-(hydroxymethyl)-4,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
[(2R,3R,4S,5R,6R)-6-[2-(3-hydroxy-4-methoxyphenyl)ethoxy]-2-(hydroxymethyl)-4,5-bis[[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy]oxan-3-yl] (E)-3-(4-hydroxy-3-methoxyphenyl)prop-2-enoate	present	LOTUS
Arillatose B	present	LOTUS
Aucubin	present	LOTUS
Catalpol	present	LOTUS
Minecoside	present	LOTUS
Mussaenoside	present	LOTUS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica pulvinaris has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSFJ848072.1 ↗622 bpNew Zealand

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCAGTAAATCAAACCGCGAACACGTGTAAATAAAATTCGCCTGCTAGACGCT …

Veronica pulvinaris isolate D Glenny 9093 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS2★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Veronica pulvinaris carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 42 n = 21

Ploidypolyploid inferred

Chromosome records42–422n range42median42mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 429×CCDB · veronic · CCDB · book-ipcn67-71

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora. - 13. Parahebe and Pygmea (Scrophulariaceae) | New Zealand J. Bot. | 8: 255-259 | 1970

CCDB · book-ipcn67-71 — HAIR, J.B. 1970. Contributions to a Chromosome Atlas of the New Zealand flora. 13. Parahebe and Pygmea (Scrophulariaceae). New Zealand J. Bot. 8: 255-259.

n 211×CCDB · veronic

CCDB · veronic — Cytology and taxonomy of Hebe, Veronica and Pygmea | Nature | 147: 117-118 | 1941

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type493 records

Wild obs. + sensor249

Museum / vouchered244

Range

Area of Occupancy AOO832 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 158≤1 km 33≤10 km 9

200 georeferenced · 49 without coordinates

Open the mapobservation + sensor249

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 3

3 georeferenced · 241 without coordinates

Open the institutions mapphysical evidence244

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	140
Wellington, NZ	97
Hobart, AU	2
Auckland, NZ	2
Flagstaff, US	1
Smithfield, AU	1

6 institutions · 243 of 244 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Veronica pulvinaris was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median5.70 °C 5.70–5.70

Seasonal swing summer↔winter12.3 °C

Max temp (day)9.20 °C

Min temp (night)1.40 °C

Precipitation130 mm/mo

Air humidity62.6 %

Moisture balance54.3 mm/mo

Vapour deficit357 Pa

Wind speed5.90 m/s

Cloud cover38.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)