Veronica odora

Hook.fil. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Lamiales/Plantaginaceae/Veronica

At a glance

Occurrence records1 924

Data sources12

Biological traits34

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Veronica odora's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 924 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Occurrence & distributionGBIF1 924 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT2 Gbp

01Narrative

Hebe odora, known as the Boxwood hebe, Mountain-box, ‘Veronica odora’ or ‘Hebe buxifolia’, is a plant in the family Plantaginaceae, and it is native to New Zealand. Hebe is the most abundant flowering plant genus in New Zealand, and it is an important part of New Zealand's natural landscape. Hebe odora was discovered on the Auckland Islands by J.D Hooker in 840. A certain amount of confusion later arose following its collection on mainland New Zealand by Ernst Dieffenbach and its naming as Hebe buxifolia by George Bentham. Even overseas, Hebe odora is still not infrequently known as Hebe buxifolia. Hebe and its relatives probably evolved from within the Veronica complex of the Northern hemisphere. In fact, until the 1920s, plants in Hebe were considered to be species of Veronica.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology12

Leaf length max20 mm

Leaf width15 mm

Leaf width max15 mm

Leaf width min15 mm

Plant height0.4 m

Plant height max1.5 m

Seed length1.8 mm

Seed length max1.8 mm

Seed length min1.8 mm

Seed mass0.4 mg

⚠ sources differ — TRY: 0.4 mg · GIFT: 0 mg

Seed mass max0 mg

Seed mass min0 mg

Life cycle & reproduction9

Deciduousnessevergreen

Dispersal typeunspecialized

Life formsubshrub or shrub

Life spanperennial

Lifespan years8 years

Pollination modebiotic

Pollination syndromeinsect

Raunkiær life formphanerophyte

Reproduction asexualabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubalpine or subarctic

Climberself-supporting

Elevation mean0 m

Epiphyteterrestrial

Growth formshrub

Habitat GIFTLowland

Woodinesswoody

Physiology & chemistry4

Leaf dry-matter content (LDMC)420 mg/g

Leaf p0.636 mg/g

Nitrogen fixingnon_nitrogen_fixer

Specific leaf area (SLA)5.4 mm²/mg

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Veronica odora has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences3

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPX021901.1 ↗613 bpAustralia · 2010

ACGT

ACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAGACCCGTAAATCGAACCGCGAACACGTGCACATAAATTCGCCCGCTAG …

Veronica odora voucher D70 from Australia small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Veronica odora carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size2 048 910 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Veronica odora2.05 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 84 n = 42

Ploidy12× 12× · measured

Chromosome records42–842n range84median84mode39records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 8422×GoaT · Kew Plant DNA C-values Database · CCDB · new-zealand · CCDB · veronic +1

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 36. Miscellaneous families | New Zealand J. Bot. | 38: 1-23 | 2000

CCDB · veronic — Chromosome atlas of flowering plants | London, George Allen & Unwin | | 1955

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · ipcn-api-dl — Dawson, M. I. & E. J. Beuzenberg. 2000. Contributions to a chromosome atlas of the New Zealand flora. New Zealand J. Bot. 38: 1–24.

2n 4216×CCDB · new-zealand · CCDB · veronic · CCDB · book-atlas-flowering-plants

CCDB · new-zealand

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 36. Miscellaneous families | New Zealand J. Bot. | 38: 1-23 | 2000

CCDB · veronic — Chromosome atlas of flowering plants | London, George Allen & Unwin | | 1955

CCDB · veronic — Studies on the cytology, genetics and taxonomy of New Zealand Hebe and Veronica (Part I). | New Zealand Jour. Sci. and Technol. | 18: 669-687 | 1937

CCDB · veronic — Contributions to a chromosome atlas of the New Zealand flora - 10 | New Zealand J. Bot. | 5:322-352 | 1967

CCDB · book-atlas-flowering-plants — Frankel unp.

2n 801×CCDB · new-zealand

CCDB · new-zealand

n 211×CCDB · veronic

CCDB · veronic — Studies on the cytology, genetics and taxonomy of New Zealand Hebe and Veronica (Part I). | New Zealand Jour. Sci. and Technol. | 18: 669-687 | 1937

n 401×CCDB · veronic

CCDB · veronic — Contribution l'tude caryologique et gntique des Veronica. | Compt. Rend. Soc. Biol. (Paris) | 117, 36: 1153-1156 | 1934

n 421×CCDB · veronic

CCDB · veronic — Studies on the cytology, genetics and taxonomy of New Zealand Hebe and Veronica (Part I). | New Zealand Jour. Sci. and Technol. | 18: 669-687 | 1937

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

12×1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

polyploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 924 records

Wild obs. + sensor1 224

Museum / vouchered696

Cultivated / captive4

Origin

Native3

Range

Area of Occupancy AOO4 248 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 862≤1 km 137≤10 km 66>10 km 23

1 088 georeferenced · 136 without coordinates

Open the mapobservation + sensor1 224

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy29% within 1 km

≤1 km 2≤10 km 3>10 km 2

7 georeferenced · 689 without coordinates

Open the institutions mapphysical evidence696

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy100% within 1 km

≤1 km 4

4 georeferenced

Open the mapnot free-living4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions9 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Christchurch, NZ	436
Wellington, NZ	241
Palmerston North, NZ	7
Mount Annan, AU	3
Armidale, AU	2
Smithfield, AU	2
Museo Entomologico de Leonlocation not on record	1
MeiseBGlocation not on record	1
La Paz, BO	1
Canberra, AU	1
Rotorua, NZ	1

11 institutions · 696 of 696 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA2 detections

Where the DNA of Veronica odora was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Veronica odora

At a glance

Sources12 archives

Size & morphology12

Life cycle & reproduction9

Diet & foraging1

Habitat & environment8

Physiology & chemistry4

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type1 924 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions9 of 11 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Record type1 924 records