Verbascum blattaria
speciesAt a glance
Occurrence records42 217
Data sources11
Biological traits54
DNA specimens13
eDNA detections7
Sources11 archives
Databases and archives Verbascum blattaria's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility42 217 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics13 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources54 traits
Chemical compositionLOTUS6 compounds
Occurrence & distributionGBIF42 217 records
Environmental DNA1 datasets · 3 countries7 detections
DNA & barcodingBOLD · NCBI13 specimens
Genome at a glanceCCDB2n = 30
01Narrative
La Molène blattaire ou Herbe-aux-mites, est une plante herbacée de la famille des Scrofulariacées.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology18
Fruit length7.5 mm
Fruit length max8 mm
Fruit length min7 mm
Fruit width7.5 mm
⚠ sources differ — AusTraits: 7.5 mm · GIFT: 7 mm
Leaf length165 mm
Leaf length max250 mm
Leaf length min80 mm
Leaf width30 mm
⚠ sources differ — AusTraits: 30 mm · GIFT: 33 mm
Leaf width max40 mm
Leaf width min20 mm
Plant height0.725 m
⚠ sources differ — GIFT: 0.725 m · AusTraits: 0.85 m · LEDA: 0.725 m · TRY: 0.75 m
Plant height generative0.85 m
Plant height max1.5 m
Plant height min0.3 m
Seed length0.7 mm
Seed mass0.107 mg
⚠ sources differ — TRY: 0.107 mg · LEDA: 0.105 mg · GIFT: 0.101 mg
Seed mass max0.144 mg
Seed mass min0.07 mg
Life cycle & reproduction14
Deciduousnessaestival
⚠ sources differ — TRY: aestival · GIFT: deciduous
Dehiscencedehiscent
Dispersal typehuman
⚠ sources differ — LEDA: agochor · GIFT: anemochorous
Flowering endAug
Flowering startJun
Flowering timeyynnnnnnyyyy
Life formbiennial
Life spanbiennial
⚠ sources differ — TRY: biennial · AusTraits: biennial · LEDA: strict monocarpic bi-annuals and poly-annuals · GIFT: biennial
Lifespan years1.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment12
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 743 m
Elevation min360 m
Epiphyteterrestrial
Fruit typecapsule
Growth formherb
Habitat GIFTLowland
Leaf compoundnesssimple
Leaf shapelanceolate oblanceolate oblong
Woodinessnon-woody
Physiology & chemistry6
Leaf c452 mg/g
Leaf n24.66 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index1
Specific leaf area (SLA)18.82 mm²/mg
Other traits2
Diaspore typeseed
Monocarpymonocarp
03Chemical composition6 compounds
Compounds documented for Verbascum blattaria across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile1 class
Iridoids monoterpenoids6
Documented compounds6 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,4aS,5S,7S,7aR)-1,4a,5,6,7,7a-Hexahydro-4a,5,7-trihydroxy-7-methylcyclopenta[c]pyran-1-yl beta-D-glucopyranoside | present | LOTUS | |
| (2R)-2-[[(1R,2S,6S)-5-hydroxy-2-(hydroxymethyl)-3,9-dioxatricyclo[4.4.0.02,4]dec-7-en-10-yl]oxy]-6-(hydroxymethyl)oxane-3,4,5-triol | present | LOTUS | |
| 2-[[7-(Hydroxymethyl)-1-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-1,4a,5,7a-tetrahydrocyclopenta[c]pyran-5-yl]oxy]-6-methyloxane-3,4,5-triol | present | LOTUS | |
| Ajugol | present | LOTUS | |
| Aucubin | present | LOTUS | |
| Harpagoside | present | LOTUS |
05DNA & barcoding13 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Verbascum blattaria has left across the world's sequence archives.
At a glance
DNA specimens13
Marker genes5
GenBank sequences10
eDNA detections7
Countries4
The DNA barcodea real sequence read deposited for this species
TGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCAT …
Verbascum blattaria voucher 9 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★ITS5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Verbascum blattaria carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 30 n = 15
Ploidydiploid inferred
Chromosome records18–322n range30median30mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3011×CCDB · slov-fl · CCDB · poland · CCDB · ipcn-api-dl +5
CCDB · slov-fl — Májovský J. et al., 1974a: Index of chromosome numbers of Slovakian flora (Part 3). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 22: 1-20.
CCDB · poland — Pogan E., Rychlewski J. et al. 1980 a. Further studies in chromosome numbers of Polish Angiosperms. Part XIV. Acta Biol. Cracov. Ser. Bot. 22, 129-153.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian flora. (Part 3). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 22: 1-20.
CCDB · book-indian_vol1 — Arts-Damler, Th. 1960
CCDB · book-fedorov — Arts"Damler 1960
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Ohri, D., R. M. Fritsch & P. Hanelt. (1998). Evolution of genome size in Allium (Alliaceae) Plant Systematics and Evolution 210: 57-86.
CCDB · iapt — IAPT/IOPB Chromosome Data 25
2n 181×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Labadie, J. P. (1976). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LIV]. Taxon 25(5/6): 636-639.
2n 321×CCDB · book-fedorov
CCDB · book-fedorov — Perino (T. 1927)
n 1510×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — KOKTAY, P. 1974. Morphological and cytological studies on the Verbascum species of Istanbul area. Rev. Fac. Sci. Univ. Istanbul, Ser. B, Sci. Nat. 39: 95–124.
CCDB · ipcn-api-dl — Hill, L. M. 1989. IOPB chromosome data 1. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 13: 17–19.
CCDB · ipcn-api-dl — Parfitt, B. D. 1981. ln Chromosome number reports LXXI. Taxon 30: 515–516.
CCDB · ipcn-api-dl — Pogan, E. 1980. Further studies in chromosome numbers of Polish Angiosperms. Acta Biol. Cracov., Ser. Bot. 22: 129–153.
CCDB · CromoCat 2015 — Hill, L. M. (1989). IOPB Chromosome Data 1 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 13: 17-19.
CCDB · CromoCat 2015 — Koktay, P. (1974). Morphological and cytological studies on the Verbascum species of Istanbul area. Revue de la Faculté des Sciences de l'Université d'Istanbul : Serie B : Sciences Naturelles 39: 95-124
CCDB · CromoCat 2015 — Ohri, D., R. M. Fritsch & P. Hanelt. (1998). Evolution of genome size in Allium (Alliaceae) Plant Systematics and Evolution 210: 57-86.
CCDB · CromoCat 2015 — Pogan, E. , Rychlewski J. , (et Ai. ). (1980). Further studies in chromosome numbers of Polish Angiosperms. Acta Biologica Cracoviensia, Series Botanica 22: 129-153.
CCDB · CromoCat 2015 — Demiriz, H. & Koktay, P. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXVIII]. Taxon 29(4): 542.
CCDB · CromoCat 2015 — Parfitt, B. D. & N. A. Harriman. (1981). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXI]. Taxon 30(2): 515-516.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=0.999 ↗
08Occurrence & distribution
Record type42 217 records
Wild obs. + sensor38 083
Museum / vouchered4 058
Cultivated / captive8
Other68
Origin
Native34
Introduced782
Range
Area of Occupancy AOO91 156 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy50% within 1 km
≤100 m 12 819≤1 km 2 826≤10 km 14 465>10 km 907
31 017 georeferenced · 7 066 without coordinates
Open the mapobservation + sensor38 083
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy46% within 1 km
≤100 m 282≤1 km 702≤10 km 1 029>10 km 104
2 117 georeferenced · 1 941 without coordinates
Open the institutions mapphysical evidence4 058
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy0% within 1 km
>10 km 6
6 georeferenced · 2 without coordinates
Open the mapnot free-living8
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions176 of 283 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| BIO-UNIPIlocation not on record | 289 |
| Philadelphia, US | 241 |
| Chongqing Museumlocation not on record | 179 |
| LDlocation not on record | 145 |
| Wuzhou, CN | 127 |
| Moscow State Universitylocation not on record | 115 |
| Berlin, DE | 103 |
| MeiseBGlocation not on record | 93 |
| Kunming, CN | 89 |
| Saint Louis, US | 69 |
| Bronx, US | 65 |
| Bloomington, US | 61 |
| Corvallis, US | 58 |
| Williamsburg, US | 57 |
| Pullman, US | 53 |
| BDBClocation not on record | 49 |
| Ann Arbor, US | 42 |
| University of Stellenboschlocation not on record | 41 |
| Allentown, US | 38 |
| Burlington, US | 37 |
| College Park, US | 36 |
| Madison, US | 36 |
| WTUlocation not on record | 35 |
| New Haven, US | 31 |
| New Brunswick, US | 31 |
| BFLlocation not on record | 31 |
| McWane Science Centerlocation not on record | 30 |
| Moscow, US | 28 |
| Uniwersytet Wrocławskilocation not on record | 28 |
| Adam Mickiewicz University in Poznańlocation not on record | 26 |
| Christchurch, NZ | 25 |
| Wlocation not on record | 25 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 25 |
| Provincia di Livornolocation not on record | 24 |
| Auckland, NZ | 23 |
| Barcelona, ES | 22 |
| SLU Artdatabankenlocation not on record | 22 |
| Davis, US | 21 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 21 |
| Bern, CH | 21 |
| Museo Entomologico de Leonlocation not on record | 20 |
| Riverside, US | 19 |
| Missoula, US | 18 |
| Canadian Department of Agriculturelocation not on record | 18 |
| Nagano City, JP | 18 |
| Mlocation not on record | 17 |
| GJOlocation not on record | 17 |
| BRNUlocation not on record | 17 |
| Flagstaff, US | 17 |
| Salzburg, AT | 17 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 16 |
| Arcata, US | 15 |
| Mount Annan, AU | 15 |
| KIRMlocation not on record | 15 |
| University of New Hampshirelocation not on record | 15 |
| Chapel Hill, US | 13 |
| Staten Island, US | 13 |
| Claremont, US | 13 |
| Jackson, US | 13 |
| Pittsburg, US | 13 |
| València, ES | 13 |
| Görlitz, DE | 12 |
| Denver, US | 12 |
| Knoxville, US | 11 |
| Columbia, US | 11 |
| BClocation not on record | 11 |
| Bozeman, US | 11 |
| Shinshu Universitylocation not on record | 11 |
| Dekalb, US | 11 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 11 |
| Wellington, NZ | 11 |
| Millersville, US | 11 |
| Fayetteville, US | 10 |
| Fort Worth, US | 10 |
| Morgantown, US | 10 |
| MAlocation not on record | 10 |
| Portland, US | 10 |
| South Kensington, GB | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| Tuscaloosa, US | 9 |
| GAlocation not on record | 9 |
| SNSNMClocation not on record | 9 |
| IDElocation not on record | 9 |
| CJBGlocation not on record | 9 |
| Université Lavallocation not on record | 8 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 8 |
| Oskarshamn, SE | 8 |
| ASUlocation not on record | 8 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 8 |
| Hobart, AU | 8 |
| BAYLUlocation not on record | 8 |
| Angwin, US | 8 |
| San Diego, US | 8 |
| Odawara, JP | 8 |
| Caldwell, US | 7 |
| Austin, US | 7 |
| Québec, CA | 7 |
| Ashland, US | 7 |
| Brussel, BE | 7 |
| PRClocation not on record | 7 |
| Urumqi, CN | 7 |
| Beijing, CN | 7 |
| Pocatello, US | 7 |
| Davenport, US | 7 |
| Cheney, US | 6 |
| Vancouver, CA | 6 |
| Boise, US | 6 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 6 |
| GB | 6 |
| Salamanca, ES | 6 |
| Norfolk, US | 6 |
| Canberra, AU | 6 |
| Entomological Society of Latvialocation not on record | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Acadia Universitylocation not on record | 5 |
| Washington, US | 5 |
| Uniwersytet Śląski w Katowicachlocation not on record | 5 |
| University of Alberta Museumslocation not on record | 5 |
| Yangling, CN | 5 |
| Minia, EG | 5 |
| Northridge, US | 5 |
| Chicago, US | 5 |
| Museum of the Rockieslocation not on record | 5 |
| Tilburg, NL | 4 |
| Zürich, CH | 4 |
| Lincoln, US | 4 |
| Victoria, CA | 4 |
| Bergen, NO | 4 |
| Paris, FR | 4 |
| Bourges, FR | 4 |
| Madrid, ES | 4 |
| CICYTEXlocation not on record | 4 |
| Chadron, US | 4 |
| UGentlocation not on record | 4 |
| Parthenon Tama History Museumlocation not on record | 4 |
| DBF-NHMDlocation not on record | 4 |
| University of Guelph, OAC Herbariumlocation not on record | 4 |
| Toronto, CA | 4 |
| Fukushima Universitylocation not on record | 4 |
| Provo, US | 4 |
| University of Tennessee at Chattanoogalocation not on record | 4 |
| San Angelo, US | 4 |
| H-Schuhwlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Banyoles, ES | 3 |
| Tacoma, US | 3 |
| Phoenix, US | 3 |
| GMBAlocation not on record | 3 |
| San Jose, US | 3 |
| Edmonton, CA | 3 |
| EL PASO, US | 3 |
| Olocation not on record | 3 |
| University of Southern Mississippilocation not on record | 3 |
| Chiba, JP | 3 |
| Clemson, US | 3 |
| Sanda, JP | 3 |
| Porrentruy, CH | 3 |
| San Sebastián, ES | 3 |
| Otaru, JP | 3 |
| Fairfax, US | 3 |
| Frankfurt am Main | 3 |
| Johnson City, US | 3 |
| JP | 3 |
| Hudson, US | 3 |
| Toyama, JP | 3 |
| Guilin, CN | 3 |
| John May Museum of Natural Historylocation not on record | 3 |
| Miami, US | 3 |
| H-Adlerlocation not on record | 3 |
| Turlock, US | 3 |
| Logan, US | 3 |
| Weber State Universitylocation not on record | 3 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 3 |
| Pamplona, ES | 2 |
| Uppsala, SE | 2 |
| Walla Walla, US | 2 |
| John T. Waterhouse Herbariumlocation not on record | 2 |
| AUAlocation not on record | 2 |
| Whitewater, US | 2 |
| PrivatHerblocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Jefferson City, US | 2 |
| Granada, ES | 2 |
| Springfield, US | 2 |
| US | 2 |
| H-Hohlalocation not on record | 2 |
| Hamilton, US | 2 |
| Fredericton Stock Culture Collectionlocation not on record | 2 |
| Rotorua, NZ | 2 |
| Bend, US | 2 |
| US | 2 |
| University of North Carolina at Pembrokelocation not on record | 2 |
| Waverly, US | 2 |
| Henderson, US | 2 |
| Weymouth Woods Sandhills Nature Preservelocation not on record | 2 |
| Badajoz, ES | 2 |
| Iwate Prefectural Museumlocation not on record | 2 |
| Mohonk Preservelocation not on record | 2 |
| Santa Barbara, US | 2 |
| Adelaide, AU | 2 |
| Natural History Museum Rotterdamlocation not on record | 2 |
| Tsukuba, JP | 2 |
| Juriquilla, MX | 2 |
| Portland, US | 2 |
| San Luis Obispo, US | 2 |
| Nijmegen, NL | 2 |
| No collectionlocation not on record | 2 |
| Severin-McDaniel Insect Collectionlocation not on record | 2 |
| Vitoria, ES | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| Frauenfeld, CH | 2 |
| Cambridge, US | 1 |
| SZUlocation not on record | 1 |
| Tennessee Technological Universitylocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Russellville, US | 1 |
| Zürich, CH | 1 |
| KNFHClocation not on record | 1 |
| Sagamihara, JP | 1 |
| VALElocation not on record | 1 |
| Santa Cruz, US | 1 |
| Monastir, TN | 1 |
| Durham, US | 1 |
| Conway, US | 1 |
| DFlocation not on record | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| US | 1 |
| Macomb, US | 1 |
| Keene State Universitylocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| DOI/NPS, Selma to Montgomery National Historic Traillocation not on record | 1 |
| Göteborg, SE | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Chicago, US | 1 |
| BG-NMNHSlocation not on record | 1 |
| Glarus, CH | 1 |
| St. Paul, US | 1 |
| Green Bay, US | 1 |
| Mississippi State, US | 1 |
| GZUlocation not on record | 1 |
| Universität Ulmlocation not on record | 1 |
| Winterthur, CH | 1 |
| Spearfish, US | 1 |
| Batemans Bay, AU | 1 |
| Jaén, ES | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| Meguro Parasitological Museumlocation not on record | 1 |
| Tomioka, JP | 1 |
| WNNUlocation not on record | 1 |
| Xining, CN | 1 |
| Kochi, JP | 1 |
| H-Wolflocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Cambridge, US | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Mexico City, MX | 1 |
| Pamplona, ES | 1 |
| H-Dunkellocation not on record | 1 |
| Guangzhou, CN | 1 |
| H-AkrKGlocation not on record | 1 |
| H-Meierottlocation not on record | 1 |
| CASlocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Oswego, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Long Beach, US | 1 |
| Durham, US | 1 |
| Mexico City, MX | 1 |
| Fredericksburg, US | 1 |
| BSBIlocation not on record | 1 |
| MEXUlocation not on record | 1 |
| Little Rock, US | 1 |
| Albuquerque, US | 1 |
| Dresden, DE | 1 |
| Kew, GB | 1 |
| Chicago, US | 1 |
| USACELPlocation not on record | 1 |
| ROM007location not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Sevilla, ES | 1 |
| Tampa, US | 1 |
| Fribourg, CH | 1 |
| Armidale, AU | 1 |
283 institutions · 3 631 of 4 058 vouchered records shown · 426 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA7 detections
Where the DNA of Verbascum blattaria was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found7
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 7 detections have coordinates
Open the map3 countries0
Piedmont desertRiparian with Salix spp., Heliotropium curas…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median19.2 °C -4.80–23.1
Seasonal swing summer↔winter26.3 °C
Max temp (day)24.6 °C -1.40–30.2
Min temp (night)14.0 °C -8.30–16.7
Precipitation72.5 mm/mo 13.3–83.9
Air humidity57.3 % 48.8–63.0
Moisture balance-65.4 mm/mo -158–50.1
Vapour deficit951 Pa 162–1,447
Wind speed3.50 m/s 2.10–4.40
Cloud cover39.9 % 23.9–55.7
CHELSA 1981–2010, ~9 km grid, at location & month of 6 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.