Venturia pyrina

Aderh. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Venturiales/Venturiaceae/Venturia

At a glance

Occurrence records455

Data sources9

Biological traits0

DNA specimens2

eDNA detections13

Sources9 archives

Databases and archives Venturia pyrina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility455 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF455 records

Environmental DNA1 datasets · 0 countries13 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT · NCBI≈41 Mbp

01Narrative

Venturia pyrina est une espèce de champignons ascomycètes de la famille des Venturiaceae. Ce champignon est responsable de la tavelure du poirier.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Venturia pyrina has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences10

eDNA detections13

Countries4

The DNA barcodea real sequence read deposited for this species

ITSPX097958.1 ↗374 bpArgentina · 2023

ACGT

CTCCACCCTTTGTAACCGCGGCCAGGATTCGGCGCCTGGCGGAGGGTACCCCCCGTTCGCGGGGGCCTCCGCCTGCCGGAATCAGCCAAC …

Venturia pyrina isolate 1814 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Venturia pyrina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈41 177 872 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Venturia pyrina0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness96.7% BUSCO

08Occurrence & distribution

Record type455 records

Wild obs. + sensor85

Museum / vouchered348

Cultivated / captive6

Other16

Range

Area of Occupancy AOO1 012 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 47≤1 km 12≤10 km 20>10 km 1

80 georeferenced · 5 without coordinates

Open the mapobservation + sensor85

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy34% within 1 km

≤100 m 5≤1 km 43≤10 km 75>10 km 19

142 georeferenced · 206 without coordinates

Open the institutions mapphysical evidence348

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 6 records without

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	45
Olocation not on record	45
Catholic University of Pekinglocation not on record	17
Auckland, NZ	15
DPIlocation not on record	13
Bronx, US	9
Pullman, US	9
Helsinki, FI	7
Tartu, EE	6
Kensington, AU	4
Chicago, US	4
Museo Entomologico de Leonlocation not on record	4
LDlocation not on record	3
Madison, US	3
Lincoln, US	3
Uppsala, SE	2
Champaign, US	2
Vancouver, CA	2
Brown Universitylocation not on record	2
Karlsruhe, DE	1
McWane Science Centerlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
St. Paul, US	1
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Norwegian Institute of Bioeconomy Researchlocation not on record	1
TENN-Flocation not on record	1
University of Tennessee at Chattanoogalocation not on record	1

27 institutions · 203 of 348 vouchered records shown · 145 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA13 detections

Where the DNA of Venturia pyrina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)