Venturia inaequalis

(Cooke) G.Winter · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Venturiales/Venturiaceae/Venturia

At a glance

Occurrence records2 252

Data sources11

Biological traits0

DNA specimens21

eDNA detections104

Sources11 archives

Databases and archives Venturia inaequalis's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility2 252 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI104 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics21 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS11 compounds

Occurrence & distributionGBIF2 252 records

Environmental DNA5 datasets · 15 countries104 detections

DNA & barcodingBOLD · NCBI21 specimens

Genome at a glanceGoaT · NCBI≈73 Mbp

01Narrative

Befallenes Blatt Ungleiche zweizellige Askosporen Konidie, die aus dem Blatt herausbricht Entwicklungszyklus des Apfelschorfs (nach Meike Piepenbring) Der Apfelschorf (Venturia inaequalis) ist eine der wichtigsten Apfelbaumkrankheiten weltweit und wird durch den Schlauchpilz Venturia inaequalis verursacht. Die Nebenfruchtform wird als Spilocaea pomi bezeichnet. Der Gattungsname ehrt den italienischen Botaniker Antonio Venturi (1805–1864), nicht den Bryologen Gustavo Venturi.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition11 compounds

Compounds documented for Venturia inaequalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols4

Ergostane steroids2

Lanostane, Tirucallane and Euphane triterpenoids1

Cholestane steroids $ Ergostane steroids1

Ergostane steroids $ Stigmastane steroids1

Documented compounds11 total

Tissue Source Quantified only

Compound	Amount	Source
(7E)-8-[(R)-methylsulfinyl]trideca-1,7-dien-3,5,9,11-tetrayne	present	NPASS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2R,3S,4R,5S,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
2-(3,4-dihydroxyphenyl)-5,7-dihydroxy-3-[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one	present	NPASS
24-Methylene-24-dihydrolanosterol	present	LOTUS
Astragalin	present	NPASS
delta7-Campesterol	present	LOTUS
Dihydroergosterol	present	LOTUS
Episterol	present	LOTUS
Ergosterol	present	LOTUS
HDLFDRNEHPOIHC-OMACXJQVSA-N	present	NPASS

05DNA & barcoding21 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Venturia inaequalis has left across the world's sequence archives.

At a glance

DNA specimens21

Marker genes1

GenBank sequences10

eDNA detections104

Countries15

The DNA barcodea real sequence read deposited for this species

ITSPZ317948.1 ↗481 bpChina · 2018

ACGT

TTCCGTAGGTGAACCTGCGGAAGGATCATTAATGGGTTAGCCTTCGGGCGCATCCCCACCCTCTGTAACCGCGGCCCGGATTCGGCGCCT …

Venturia inaequalis strain XJZS1-13-6 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Venturia inaequalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈72 791 559 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Venturia inaequalis0.07 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness97.1% BUSCO

08Occurrence & distribution

Record type2 252 records

Wild obs. + sensor615

Museum / vouchered1 589

Cultivated / captive43

Other5

Range

Area of Occupancy AOO5 088 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy64% within 1 km

≤100 m 257≤1 km 87≤10 km 179>10 km 16

539 georeferenced · 76 without coordinates

Open the mapobservation + sensor615

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy12% within 1 km

≤100 m 21≤1 km 129≤10 km 900>10 km 166

1 216 georeferenced · 373 without coordinates

Open the institutions mapphysical evidence1 589

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 43 records without

Open the mapnot free-living43

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions27 of 47 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	660
Bernard Price Institute for Palaeontological Researchlocation not on record	205
DPIlocation not on record	69
Catholic University of Pekinglocation not on record	65
Helsinki, FI	42
Pullman, US	31
Auckland, NZ	31
Lincoln, US	29
Zürich, CH	26
Tartu, EE	25
Academy of Sciences of the Republic of Uzbekistanlocation not on record	19
Madison, US	18
Champaign, US	17
TENN-Flocation not on record	15
St. Paul, US	13
Museo Entomologico de Leonlocation not on record	10
Kensington, AU	10
Kuopio, FI	8
Université de Montréal Biodiversity Centrelocation not on record	8
Toronto, CA	6
FLASlocation not on record	5
Karlsruhe, DE	5
University of Tennessee at Chattanoogalocation not on record	4
LDlocation not on record	4
Hirosaki Universitylocation not on record	3
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	3
Vancouver, CA	3
Uppsala, SE	3
Canberra, AU	3
Bronx, US	3
WU-MYClocation not on record	3
PHlocation not on record	2
Chicago, US	2
Hobart, AU	2
Ann Arbor, US	2
Copenhagen, DK	2
Uniwersytet Wrocławskilocation not on record	1
Clemson, US	1
Canadian Department of Agriculturelocation not on record	1
Umeå Universitylocation not on record	1
Durango, MX	1
Gijón, ES	1
Baton Rouge, US	1
Nurata nature reservelocation not on record	1
Mlocation not on record	1
Oskarshamn, SE	1
Görlitz, DE	1

47 institutions · 1 367 of 1 589 vouchered records shown · 221 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA104 detections

Where the DNA of Venturia inaequalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found104

Studies independent surveys5

Countries15

Verifiable raw sequence linked1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 104 detections have coordinates

Open the map15 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.2 °C 1.70–15.0

Seasonal swing summer↔winter22.4 °C

Max temp (day)14.2 °C 3.10–19.0

Min temp (night)5.60 °C -0.5–10.5

Precipitation71.2 mm/mo 35.4–124

Air humidity60.0 % 56.3–68.3

Moisture balance-18.5 mm/mo -53.7–86.0

Vapour deficit543 Pa 200–712

Wind speed3.10 m/s 2.50–5.20

Cloud cover43.7 % 35.2–71.3

CHELSA 1981–2010, ~9 km grid, at location & month of 83 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Venturia inaequalis

At a glance

Sources11 archives

Compound class profile5 classes

Documented compounds11 total

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type2 252 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions27 of 47 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type2 252 records