Vampyroteuthis infernalis

Chun, 1903 · species

image placeholder — illustration coming later

Animalia/Mollusca/Cephalopoda/Vampyromorpha/Vampyroteuthidae/Vampyroteuthis

At a glance

Occurrence records1 163

Data sources13

Biological traits6

DNA specimens57

eDNA detections50

Sources13 archives

Databases and archives Vampyroteuthis infernalis's data was compiled from.

WikipediaWikimedia Foundation19 languages↗

Animal Diversity WebUniv. of Michigan MZspecies account↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility744 records↗

OBISOcean Biodiversity Information System419 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI50 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics57 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

Paleobiology DatabasePBDB consortiumfossil record↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeADW · Wikipediaarticle

Traits & measurements1 literature sources6 traits

Occurrence & distributionGBIF · OBIS1 163 records

Environmental DNA2 datasets · 6 countries50 detections

DNA & barcodingBOLD57 specimens

Genome at a glanceGoaT · NCBI≈14.7 Gbp

01Narrative

The vampire squid (Vampyroteuthis infernalis, lit. 'vampire squid from hell') is a small cephalopod found throughout temperate and tropical oceans in extreme deep sea conditions. The vampire squid uses its bioluminescent organs and its unique oxygen metabolism to thrive in the parts of the ocean with the lowest concentrations of oxygen. It has two long retractile filaments, located between the first two pairs of arms on its dorsal side, which distinguish it from both octopuses and squids, and places it in its own order, Vampyromorphida, although its closest relatives are octopods. As a phylogenetic relict, it is the only known surviving member of its order. The first specimens were collected on the Valdivia Expedition and were originally described as an octopus in 1903 by German teuthologist Carl Chun, but later assigned to a new order together with several extinct taxa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Size & morphology1

Body length13 cm

Habitat & environment2

Habitat saltwateryes

Habitat zonepelagic

Other traits3

Depth max3 000 m

Depth min100 m

Vulnerability10

05DNA & barcoding57 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vampyroteuthis infernalis has left across the world's sequence archives.

At a glance

DNA specimens57

BINs4

Marker genes12

eDNA detections50

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus42 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

3Tmostly conserved

6Amostly conserved

72Gvariable

180Gvariable

189Tmostly conserved

216Avariable

315Avariable

363Avariable

372Gvariable

399Avariable

402Tvariable

450Cmostly conserved

474Avariable

510Avariable

517Cvariable

528Avariable

549Avariable

618Avariable

639Cvariable

ACTTTATATTTTATTTTAGGTATTTGATCAGGTTTATTAGGAACATCTTTAAGTTTAATAATTCGAACAGAGCTTGGACAACCAGGATCC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.9%

Haplotypes12

BINs3

Most divergent pair2.9%

N.AmericaOtherOceania

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5PCOIICOXIIICYTBND1ND2ND3ND4ND4LND5-0ND6

animal barcoderibosomalmitochondrial

Organelle genome

Besides the big genome in the nucleus, cells carry a small, circular loop of DNA inside the cell's energy factories — the mitochondria. It is inherited almost only from the mother and is a leftover from ancient bacteria that moved into the cell. The mitochondrial markers above (ND*, COX, CYTB…) are read from exactly this loop. Outer ring = one strand, inner ring = the other.

▸ Tap any coloured segment — or a gene chip — to see what it is

Mitochondrion

NC_009689 ↗ · 13 protein · 22 tRNA · 2 rRNA

COX3ND3ND2COX1COX2ATP8ATP6ND5ND4ND4LCYTBND6ND1rrnLrrnS

◖ violet arc = the COI-5P barcode — the ~650 bp read used to ID this species

Pick a coloured segment on the ring — or a gene chip — to read what that gene does.

protein-codingrRNAtRNA

06Genome at a glanceGoaT · NCBI

The complete instruction manual Vampyroteuthis infernalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈14 690 897 198 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Vampyroteuthis infernalis14.69 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelContig

07Deep time~286 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin286 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

How it livedPBDB

Environmentmarine

Life habitnektonic

Dietcarnivore

Motilityfast-moving

Visionwell-developed

Compositionaragonite

08Occurrence & distribution

Record type1 163 records

Wild obs. + sensor329

Museum / vouchered823

Cultivated / captive1

Other10

Origin

Native4

Range

Area of Occupancy AOO2 688 km²

Depth

0–200 m sunlit5

200–1000 m twilight226

1–4 km midnight127

>4 km abyssal4

median 751 m · max 7 555 m · 362 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 14≤1 km 65>10 km 1

80 georeferenced · 249 without coordinates

Open the mapobservation + sensor329

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 9≤1 km 28≤10 km 51>10 km 7

95 georeferenced · 728 without coordinates

Open the institutions mapphysical evidence823

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 30 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Santa Barbara Museum of Natural Historylocation not on record	371
Washington, US	68
UM-RSMASlocation not on record	46
Museums Victorialocation not on record	26
Earth Sciences New Zealandlocation not on record	24
Chicago, US	14
Wellington, NZ	12
New Haven, US	11
Sydney, AU	10
Tasmanian Museum & Art Gallerylocation not on record	10
CASlocation not on record	10
ICM-CSIClocation not on record	8
Delaware Museum of Nature and Sciencelocation not on record	8
South Kensington, GB	7
Victoria, CA	5
Copenhagen, DK	4
Texas Cooperative Wildlife Collectionlocation not on record	4
ZMB/Molllocation not on record	3
The Atlantic reference Centrelocation not on record	3
Cambridge, US	3
DOI/NPS, Salem Maritime National Historic Sitelocation not on record	3
South African Institute for Aquatic Biodiversitylocation not on record	3
Australian National Fish Collectionlocation not on record	2
Los Angeles, US	1
IEOlocation not on record	1
Philadelphia, US	1
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	1
IEO-COMA-CSIClocation not on record	1
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	1
Western Australian Museumlocation not on record	1

30 institutions · 662 of 823 vouchered records shown · 14 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA50 detections

Where the DNA of Vampyroteuthis infernalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found50

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 50 detections have coordinates

Open the map6 countries0

Atlantic Ocean

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 17.9–25.0

Seasonal swing summer↔winter27.0 °C

Max temp (day)23.7 °C 20.8–30.7

Min temp (night)20.6 °C 13.2–22.9

Precipitation117 mm/mo 37.7–134

Air humidity57.4 % 56.8–64.8

Moisture balance-30.6 mm/mo

Vapour deficit997 Pa 858–1,370

Wind speed6.00 m/s

Cloud cover35.7 % 25.6–39.0

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Vampyroteuthis infernalis

At a glance

Sources13 archives

Size & morphology1

Habitat & environment2

Other traits3

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

How it livedPBDB

Record type1 163 records

Origin

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions11 of 30 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 163 records