Valsaria insitiva

(Tode) Ces. & De Not. · species

image placeholder — illustration coming later

Fungi/Ascomycota/Dothideomycetes/Valsariales/Valsariaceae/Valsaria

At a glance

Occurrence records356

Data sources8

Biological traits0

DNA specimens1

eDNA detections48

Sources8 archives

Databases and archives Valsaria insitiva's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility356 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI48 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF356 records

Environmental DNA8 datasets · 11 countries48 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Valsaria insitiva is a plant pathogen, that causes perennial canker in apples and almonds.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Valsaria insitiva has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences9

eDNA detections48

Countries11

The DNA barcodea real sequence read deposited for this species

ITSMN900276.1 ↗204 bp

ACGT

CCGCGGAAGGATCATTAAAAGAGAGCGGCCGCCCCTCGCGGGCGGCCACCCCTCTACCCCTTGAATTCGCACACCGCGTAGCCCCCCCGG …

Valsaria insitiva clone ASV2474 internal transcribed spacer 1, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type356 records

Wild obs. + sensor91

Museum / vouchered258

Other7

Range

Area of Occupancy AOO844 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy13% within 1 km

≤100 m 3≤1 km 4≤10 km 49

56 georeferenced · 35 without coordinates

Open the mapobservation + sensor91

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy17% within 1 km

≤100 m 1≤1 km 30≤10 km 106>10 km 48

185 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence258

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 36 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	85
Bronx, US	16
Catholic University of Pekinglocation not on record	16
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	12
WU-MYClocation not on record	11
Madison, US	10
Pullman, US	10
Olocation not on record	9
Chicago, US	9
Toronto, CA	8
Lincoln, US	7
ILLSlocation not on record	5
Kew, GB	5
DPIlocation not on record	4
Brown Universitylocation not on record	4
Cincinnati, US	4
PHlocation not on record	4
Museo Entomologico de Leonlocation not on record	3
Ann Arbor, US	2
Auckland, NZ	2
Uppsala, SE	2
Tilburg, NL	2
Clemson, US	2
San Sebastián, ES	1
CA	1
TENN-Flocation not on record	1
Champaign, US	1
MeiseBGlocation not on record	1
McWane Science Centerlocation not on record	1
Gijón, ES	1
TFC Miclocation not on record	1
SLU Artdatabankenlocation not on record	1
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
GJOlocation not on record	1
Copenhagen, DK	1
TROMlocation not on record	1

36 institutions · 245 of 258 vouchered records shown · 13 without an institution code

09Environmental DNA48 detections

Where the DNA of Valsaria insitiva was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found48

Studies independent surveys8

Countries11

Verifiable raw sequence linked7

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 48 detections have coordinates

Open the map11 countries0

AfrotropicPalearcticNearctic

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

pH5.40

Conductivity157 µS/cm

Organic carbon3.70 %

Water content12.5 %

Nitrate-N140 mg/kg

Phosphorus10.0 mg/kg

Clay24.0 %

Sand54.0 %

Depth0 m

SoilTenosols

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.0 °C 12.5–22.0

Seasonal swing summer↔winter27.8 °C

Max temp (day)27.6 °C 16.8–27.6

Min temp (night)13.9 °C 7.40–14.5

Precipitation5.50 mm/mo 5.50–112

Air humidity39.8 % 39.8–59.7

Moisture balance-124 mm/mo -124–46.9

Vapour deficit1,940 Pa 670–1,940

Wind speed2.40 m/s 2.40–4.30

Cloud cover21.6 % 21.6–43.2

CHELSA 1981–2010, ~9 km grid, at location & month of 37 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)