Valeria oleagina

(Denis & Schiffermüller) , 1775 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Valeria

At a glance

Occurrence records1 295

Data sources7

Biological traits2

DNA specimens38

eDNA detections21

Sources7 archives

Databases and archives Valeria oleagina's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 295 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI21 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics38 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 295 records

Environmental DNA1 datasets · 10 countries21 detections

DNA & barcodingBOLD38 specimens

01Narrative

The green-brindled dot (Valeria oleagina) is a species of moth of the family Noctuidae. It is found in Southern Europe and the Middle East, then east up to Iran and Ukraine. In Germany it is found up to the Eifel and Ahr.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding38 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Valeria oleagina has left across the world's sequence archives.

At a glance

DNA specimens38

BINs2

Marker genes14

eDNA detections21

Countries12

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus20 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

73Amostly conserved

274Amostly conserved

283Cmostly conserved

388Tmostly conserved

445Cmostly conserved

478Amostly conserved

505Cmostly conserved

508Cmostly conserved

544Cmostly conserved

628Gmostly conserved

AACTTTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTACTAATTCGAGCAGAATTAGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.33%

Haplotypes4

BINs2

Most divergent pair1.8%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Apamea centralissame family7.1%Phidrimana amurensissame family7.2%Bagisara brouanasame family7.6%Dichagyris celsicolasame family7.8%Bagisara albicostasame family7.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P16Satp6ATP8COIICOXIIICYTBND1ND2ND3ND4ND4LND6MT-NADH5

animal barcoderibosomalmitochondrialmarker

08Occurrence & distribution

Record type1 295 records

Wild obs. + sensor1 184

Museum / vouchered106

Other5

Origin

Native16

Range

Area of Occupancy AOO2 148 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy77% within 1 km

≤100 m 388≤1 km 120≤10 km 148>10 km 5

661 georeferenced · 523 without coordinates

Open the mapobservation + sensor1 184

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy51% within 1 km

≤100 m 14≤1 km 25≤10 km 35>10 km 2

76 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence106

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Radicondoli, IT	13
Zürich, CH	11
Sion, CH	10
John May Museum of Natural Historylocation not on record	10
Provincia di Livornolocation not on record	9
ZSMlocation not on record	8
Muzeum Górnośląskie w Bytomiulocation not on record	8
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	7
Bern, CH	5
Bavarian State Collection of Zoologylocation not on record	5
Uniwersytet Łódzkilocation not on record	3
Archäologie und Museum Baselland - Museum.BLlocation not on record	2
Philadelphia, US	2
European Distributed Institute of Taxonomy (EDIT)location not on record	1
NHMOlocation not on record	1
Natural History Museum Rotterdamlocation not on record	1

16 institutions · 96 of 106 vouchered records shown · 10 without an institution code

09Environmental DNA21 detections

Where the DNA of Valeria oleagina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found21

Studies independent surveys1

Countries10

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 21 detections have coordinates

Open the map10 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median9.00 °C 5.60–12.1

Seasonal swing summer↔winter17.4 °C

Max temp (day)12.4 °C 9.50–15.6

Min temp (night)3.20 °C 1.10–7.50

Precipitation76.7 mm/mo 43.0–97.5

Air humidity58.7 % 56.3–61.1

Moisture balance-4.10 mm/mo -37.3–66.8

Vapour deficit462 Pa 379–594

Wind speed3.60 m/s 2.30–6.30

Cloud cover42.5 % 39.1–47.0

CHELSA 1981–2010, ~9 km grid, at location & month of 21 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Valeria oleagina

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 295 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions5 of 16 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 295 records