Vaccinium uliginosum
speciesAt a glance
Occurrence records257 945
Data sources16
Biological traits143
DNA specimens164
eDNA detections76
Sources16 archives
Databases and archives Vaccinium uliginosum's data was compiled from.
WikipediaWikimedia Foundation2 languages↗
GBIFGlobal Biodiversity Information Facility257 945 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI76 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics164 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
phenolexplorercompounds
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements5 literature sources143 traits
Chemical compositionFooDB · NPASS · PhenolExplorer5 578 compounds
Occurrence & distributionGBIF257 945 records
Environmental DNA2 datasets · 16 countries76 detections
DNA & barcodingBOLD · NCBI164 specimens
Genome at a glanceCCDB · GoaT · NCBI1.5 Gbp
01Narrative
Vaccinium uliginosum (bog bilberry, bog blueberry, northern bilberry or western blueberry) is a Eurasian and North American flowering plant in the genus Vaccinium within the heath family.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDAUSDATRYWCVP
Size & morphology24
Fruit length8.65 mm
Fruit length max10 mm
Fruit length min10 mm
Fruit width8.35 mm
Fruit width max10 mm
Fruit width min10 mm
Leaf length19 mm
Leaf length max28 mm
Leaf length min10 mm
Leaf mass7.21 mg
Leaf size126 mm²
⚠ sources differ — TRY: 126 mm² · LEDA: 97.23 mm² · GIFT: 113 mm²
Leaf width max15 mm
Leaf width min6 mm
Plant height0.55 m
⚠ sources differ — GIFT: 0.55 m · LEDA: 0.13 m · USDA: 0.61 m · TRY: 0.094 m
Plant height generative0.083 m
Plant height max1.2 m
Plant height min0.05 m
Seed length1.55 mm
Seed mass0.233 mg
⚠ sources differ — TRY: 0.233 mg · LEDA: 0.246 mg · GIFT: 12.14 mg
Seed mass max0.77 mg
Seed mass min0.106 mg
Seed volume0.19 mm³
Seed volume max0.19 mm³
Seed volume min0.19 mm³
Life cycle & reproduction36
Bloom periodEarly Summer
Coppice potentialNo
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flower colourpurple
Flower conspicuousYes
Flowering endJun
Flowering startMay
Fruit seed period beginSummer
Fruit seed period endSummer
Growth rate USDAModerate
Life formsubshrub or shrub
Life spanperennial
Lifespan categoryModerate
Lifespan years27 years
Pollination modebiotic
Pollination syndromeinsect
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsYes
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formchamaephyte
Reproduction asexualabsent
Resprout abilityYes
Seed number19.75
Seed spread rateSlow
Seedling vigorLow
Self fertilizationabsent
Sex typehermaphrodite
Vegetative spread rateSlow
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsNo
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatesubalpine or subarctic
Climberself-supporting
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerPorous
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourblue
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
Growth form USDAMultiple Stem
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf formelliptic
Leaf retentionNo
Low growing grassNo
Mycorrhiza typeericoid
Root depth min12 in
Shape and orientationSemi-Erect
Small grainNo
Woodinesswoody
⚠ sources differ — TRY: woody · LEDA: semi-woody · GIFT: woody
Physiology & chemistry27
Anaerobic toleranceNone
C:N ratioMedium
Caco3 toleranceNone
Cold stratification requiredYes
Drought toleranceLow
Fertility requirementLow
Fire resistantNo
Fire toleranceHigh
Frost free days min90 days
Leaf C:N ratio27.92 g/g
Leaf c504 mg/g
Leaf dry-matter content (LDMC)418 mg/g
Leaf n19.68 mg/g
Leaf p1.1 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max45 in
Precipitation min18 in
Salinity toleranceNone
Seed longevity index0
Shade toleranceMedium
Soil pH max5.7 pH
Soil pH min4.5 pH
Specific leaf area (SLA)13.75 mm²/mg
⚠ sources differ — TRY: 13.75 mm²/mg · LEDA: 13.66 mm²/mg · GIFT: 14.48 mm²/mg
Temperature min-38 °F
Wood density476 mg/cm³
Uses & economy14
Berry nut seed productYes
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productNo
Palatable browse animalMedium
Palatable graze animalLow
Palatable humanYes
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits11
Diaspore typefruit
Fall conspicuousNo
Fruit seed abundanceMedium
Fruit seed conspicuousYes
Fruit seed persistenceNo
Height at 20yr0.61 m
Leaf marginentire
Leaf spinesno
Leaf thornsno
Planting density max4 800 per acre
Planting density min2 700 per acre
03Chemical composition5 578 compounds
Compounds documented for Vaccinium uliginosum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Aminoacids67
Glycerophospholipids57
Cinnamic acids and derivatives33
Purine nucleos(t)ides26
Monosaccharides25
Documented compounds5 578 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Quercetin | 17.7 mg/100 g | FooDB | |
| Myricetin | 13.653 mg/100g | FooDB | |
| trans-Caffeic acid | 9.533 mg/100g | FooDB | |
| caffeic acid | 9.533 mg/100 g fresh weight | PhenolExplorer | |
| p-coumaric acid | 5.257 mg/100 g fresh weight | PhenolExplorer | |
| trans-p-Coumaric acid | 5.257 mg/100g | FooDB |
05DNA & barcoding164 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vaccinium uliginosum has left across the world's sequence archives.
At a glance
DNA specimens164
Marker genes8
GenBank sequences7
eDNA detections76
Countries17
The DNA barcodea real sequence read deposited for this species
TGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCTGAAGCCATTAGGTTGAAGGCACGTCTGCCTGGGCGTCACGCATT …
Vaccinium uliginosum voucher EDNA21-0061088 internal transcribed spacer region, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL3★rbcLa★trnL-F★ITS2★ITS1★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Vaccinium uliginosum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 476 780 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Vaccinium uliginosum1.48 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 48 n = 24
Ploidypolyploid inferred
Chromosome records24–722n range48median48mode62records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 4833×CCDB · slov-fl · CCDB · fl-europaea · CCDB · book-ipcn65 +8
CCDB · slov-fl — Hindáková M., 2000: Karyologické štúdium slovenskej flóry XXX. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 40: 23-25.
CCDB · slov-fl — Májovský J. & Uhríková A., 1982: Karyotaxonomisches Studium einiger Arten der Flora der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 97-102.
CCDB · slov-fl — Uhríková A., Paclová L. & Dúbravcová Z., 1980: [Report], pp. 730. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · slov-fl — Májovský J., Uhríková A., Javorčíková D., Mičieta K., Králik E., Dúbravcová Z., Feráková V., Murín A., Černušáková D., Hindáková M., Schwarzová T. & Záborský J., 2000: Prvý doplnok karyotaxonomického prehľadu flóry Slovenska. - Acta Fac. Rerum Nat. Univ. Comen., Bot. Supplementum Nr. 1: 1-127.
CCDB · fl-europaea — Rousi, 1967
CCDB · book-ipcn65 — Love & L. 1965a.
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Majovsky, J. & A. Uhrikova. 1982. Karyotaxonomisches Studium einiger arten der flora der Slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 97–102.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Murin, A., I. Haberova & C. Zamsran. 1984. Further karyological studies of the Mongolian flora. Folia Geobot. Phytotax. 19: 28–39.
CCDB · ipcn-api-dl — Lippert, W. & G. R. Heubl. 1989. Chromosomenzahlen von Pflanzen aus Bayern und angrenzenden Gebieten: [Teil 2]. Ber. Bayer. Bot. Ges. 60: 73–83.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · ipcn-api-dl — Uhrikova, A., L. Paclova & Z. Dubravcova. 1980. In Chromosome number reports LXIX. Taxon 29:730.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. & V. V. Petrovsky. 1976. Chromosome numbers of some Western Chukolka plant species, II. Bot. Žhurn. (Moscow & Leningrad) 61(7): 963–969.
CCDB · ipcn-api-dl — Gregor, T. & R. Hand. 2009. Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46.
CCDB · ipcn-api-dl — Borgen, L. & R. Elven. 1983. Chromosome numbers of flowering plants from northern Norway and Svalbard. Nord. J. Bot. 3: 301–306.
CCDB · ipcn-api-dl — ZHUKOVA, P. G. 1980. Chromosome numbers of some Southern Chukotka plant species. Bot. Zhurn. 65 (1): 51–59.
CCDB · book-ipcn66 — Love & Love 1966b
CCDB · book-ipcn72 — ENGELSKJOEN, T., & G. KNABEN. 1971. Chromosome numbers of Scandinavian arctic-alpine plant species. III. Acta Boreal., A, Scientia No. 28: 1-30.
CCDB · book-ipcn67-71 — ROUSI, A. 1966. The use of North-European Vaccinium species in blueberry breeding. Act. Agric. Scand., Suppl. 16: 50-54.
CCDB · book-ipcn67-71 — ROUSI, A. 1967. Cytological observations on some species and hybrids of Vaccinium. Zuchter 36: 352-359.
CCDB · book-northern-plants — Hagerup 1933.
CCDB · book-fedorov — LOve A. 1954b
CCDB · book-fedorov — Love A, Love D. 1956b, 1966
CCDB · book-fedorov — CoKoJioscKaH, CTpeJIKoBa 1960
CCDB · book-fedorov — Hedberg L., Hedberg 0. 1961
CCDB · Cave1956 — Love & Love b
CCDB · CromoCat 2015 — Gregor, T. & Hand, R. (2009). Chromosomenzahlen von Farn- und Samenpflanzen aus Deutschland 4. Kochia 4: 37–46
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1982b). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXV]. Taxon 31(2): 344-360.
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Uhríková, A., L. Paclová & Z. Dúbravcová. (1980). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXIX]. Taxon 29(5): 730.
CCDB · CromoCat 2015 — Löve, A. & Löve, D. (1964). Reports [In Löve, A. & O. T. Solbrig (eds.) IOPB chromosome numbers reports II]. Taxon 13(2): 201-209.
2n 2427×CCDB · slov-fl · CCDB · iapt · CCDB · fl-europaea +7
CCDB · slov-fl — Májovský J. & Uhríková A., 1982: Karyotaxonomisches Studium einiger Arten der Flora der Slowakei. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 97-102.
CCDB · slov-fl — Uhríková A., Paclová L. & Dúbravcová Z., 1980: [Report], pp. 730. - In: Löve Á. (ed.), Chromosome number reports LXIX, Taxon 29 /5-6.
CCDB · iapt — IAPT/IOPB Chromosome Data 12
CCDB · fl-europaea — LOve & LOve, 1956
CCDB · book-ipcn65 — Love & L. 1965a
CCDB · ipcn-api-dl — Love, A. & D. Love. 1982. In: A Löve (ed.), IOPB chromosome number reports LXXV. Taxon 31(2): 344–360.
CCDB · ipcn-api-dl — Majovsky, J. & A. Uhrikova. 1982. Karyotaxonomisches Studium einiger arten der flora der Slowakei. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 29: 97–102.
CCDB · ipcn-api-dl — Uhrikova, A., L. Paclova & Z. Dubravcova. 1980. In Chromosome number reports LXIX. Taxon 29:730.
CCDB · ipcn-api-dl — Chinnappa, C. C. & J. G. Chmielewski. 1987. Documented plant chromosome numbers 1987: 1. Miscellaneous counts from western North America. Sida 12: 409–417.
CCDB · ipcn-api-dl — Krogulevich, R. E. 1976. Rol poliploidii v genesise flory Putorana. In: L. I. Malyshev, ed. 1976 Flora Putorana: Materali k Poznaniiu Osobennostei Sostava i Genezisia Gornykh Subarkticheskikh Flor Sibir. Novosibirsk. Nauka, Novosibirsk
CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — López Pacheco, M. J., R. A. Redondo, A. F. Rodríguez, J. I. A. Felpete, C. A. Casado & E. P. Garcia. 2002. Números cromosomáticos de plantas occidentales, 910--920. Anales Jard. Bot. Madrid 59(2): 287.
CCDB · book-ipcn66 — LOve & Love 1966b; Love & Boscaiu 1966
CCDB · book-ipcn66 — Zhukova 1966
CCDB · book-ipcn67-71 — JOHNSON, A.W., & J.G. PACKER. 1968. Chromosome numbers in the flora of Ogotruk Creek, N.W. Alaska. Bot. Not. 121: 403-456.
CCDB · book-ipcn67-71 — HEDBERG, o. 1967. Chromosome numbers of vascular plants from arctic and subarctic North America. Ark. f. Bot. Ser. 2. 6: 309-326.
CCDB · book-fedorov — LOve A., LOve D.
CCDB · book-fedorov — C. n. I. 1964)
CCDB · book-fedorov — Love D., Bo~cam 1966
CCDB · book-fedorov — Love A., Love D. 1966
CCDB · book-fedorov — Flovik 1940
CCDB · book-fedorov — Hara H. 1956
CCDB · book-fedorov — Jorgensen et al. 1958 ffiyKOBa 1966
CCDB · Cave1958 — Jorgensen et al. 1958
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — López Pacheco & al. (2001). Números cromosomáticos de plantas occidentales, 910-920. Anales Jard. Bot. Madrid 59(2): 287.
2n 722×CCDB · book-fedorov · CCDB · CromoCat 2015
CCDB · book-fedorov — Hara H. 1954
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
2n 391×CCDB · brit-fl
CCDB · brit-fl — McAllister, H.A., Stewart, W.S. Watsonia 17: 359 (1989)
n 246×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · book-ipcn73-74 +1
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · book-ipcn67-71 — ROUSI, A. 1966. The use of North-European Vaccinium species in blueberry breeding. Act. Agric. Scand., Suppl. 16: 50-54.
CCDB · book-ipcn67-71 — ROUSI, A. 1967. Cytological observations on some species and hybrids of Vaccinium. Zuchter 36: 352-359.
CCDB · book-ipcn73-74 — PACKER, J. G., & G.D. MCPHERSON. 1974. Chromosome numbers in some vascular plants from northern Alaska. Canad. J. Bot. 52: 1095-1099.
CCDB · book-ipcn73-74 — POJAR, J. 1973. Levels of polyploidy in four vegetation types of southwestern British Columbia. Canad. J. Bot. 51: 621-628. I
CCDB · CromoCat 2015 — Uotila, P. & K. Pellinen. (1985). Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130: 1-37.
n 01×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Provontova, N. S & Kazanovsky, S .G & Rudyka, E.G & Barkalov, V.Y & Seledets, V.P & Nechaev, V.A (2011). IAPT/IOPB Chromosome Data 12 Taxon 60:1790-1794
n 361×CCDB · book-ipcn73-74
CCDB · book-ipcn73-74 — YOUNG, S.B. 1970. On the taxonomy and distribution of Vaccinium uliginosum. Rhodora 72: 439-459.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelContig
07Deep time~4.83 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin4.83 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type257 945 records
Wild obs. + sensor244 160
Museum / vouchered12 128
Cultivated / captive57
Fossil102
Other1 498
Origin
Native1 842
Range
Area of Occupancy AOO363 444 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy65% within 1 km
≤100 m 85 702≤1 km 55 660≤10 km 72 109>10 km 2 412
215 883 georeferenced · 28 277 without coordinates
Open the mapobservation + sensor244 160
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy40% within 1 km
≤100 m 415≤1 km 1 654≤10 km 2 731>10 km 374
5 174 georeferenced · 6 954 without coordinates
Open the institutions mapphysical evidence12 128
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy38% within 1 km
≤100 m 2≤1 km 4>10 km 10
16 georeferenced · 41 without coordinates
Open the mapnot free-living57
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions140 of 256 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Olocation not on record | 3 058 |
| Uniwersytet Wrocławskilocation not on record | 2 179 |
| Moscow State Universitylocation not on record | 621 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 517 |
| LDlocation not on record | 285 |
| Salzburg, AT | 253 |
| Vancouver, CA | 188 |
| Université Lavallocation not on record | 164 |
| MeiseBGlocation not on record | 163 |
| Québec, CA | 117 |
| Trondheim, NO | 114 |
| Adam Mickiewicz University in Poznańlocation not on record | 114 |
| Oulu, FI | 111 |
| Oskarshamn, SE | 95 |
| Corvallis, US | 93 |
| Turku, FI | 92 |
| Montréal, CA | 89 |
| TROMlocation not on record | 85 |
| Victoria, CA | 82 |
| Chongqing Museumlocation not on record | 79 |
| WINlocation not on record | 79 |
| Garðabær, IS | 78 |
| Toronto, CA | 78 |
| WTUlocation not on record | 70 |
| Jyväskylä, FI | 70 |
| Bergen, NO | 68 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 67 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 58 |
| University of Stellenboschlocation not on record | 58 |
| BFLlocation not on record | 53 |
| Provincia di Livornolocation not on record | 52 |
| Tartu, EE | 51 |
| Kuopio, FI | 50 |
| Burlington, US | 45 |
| Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record | 44 |
| Bronx, US | 40 |
| Bern, CH | 39 |
| TUR-Alocation not on record | 38 |
| Northeastern Forestry Universitylocation not on record | 37 |
| KMNlocation not on record | 37 |
| University of Alberta Museumslocation not on record | 37 |
| Missoula, US | 36 |
| Philadelphia, US | 35 |
| SLU Artdatabankenlocation not on record | 35 |
| Pullman, US | 35 |
| MAlocation not on record | 34 |
| Kandalaksha State Nature Reservelocation not on record | 33 |
| 33 | |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 32 |
| Paris, FR | 30 |
| Mlocation not on record | 30 |
| Tallinn, EE | 29 |
| Karlsruhe, DE | 28 |
| Görlitz, DE | 27 |
| BRNUlocation not on record | 27 |
| ENTClocation not on record | 26 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 26 |
| Montréal, CA | 24 |
| Odawara, JP | 24 |
| Beijing, CN | 23 |
| Anchorage, US | 23 |
| Claremont, US | 23 |
| Madison, US | 23 |
| València, ES | 22 |
| Acadia Universitylocation not on record | 21 |
| Arcata, US | 20 |
| Zürich, CH | 20 |
| Knoxville, US | 19 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 18 |
| 东北师范大学自然博物馆location not on record | 18 |
| Fort Worth, US | 18 |
| Yukon Universitylocation not on record | 17 |
| Moscow, US | 17 |
| Zürich, CH | 16 |
| University of New Hampshirelocation not on record | 16 |
| Porvoo, FI | 15 |
| Uppsala, SE | 15 |
| FFPRIlocation not on record | 15 |
| Dresden, DE | 15 |
| Entomological Society of Latvialocation not on record | 15 |
| Saint Louis, US | 15 |
| Canadian Museum of Naturelocation not on record | 14 |
| Rovaniemi, FI | 14 |
| Tromso University Museumlocation not on record | 14 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 13 |
| Trois-Rivières, CA | 13 |
| Wuzhou, CN | 13 |
| Kyoto Universitylocation not on record | 12 |
| Memorial University of Newfoundlandlocation not on record | 12 |
| Helsinki, FI | 12 |
| Chengdu, CN | 12 |
| Porrentruy, CH | 11 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 11 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 11 |
| Madrid, ES | 11 |
| Orem, US | 11 |
| Angwin, US | 11 |
| Voronezh State Universitylocation not on record | 9 |
| BClocation not on record | 9 |
| Edinburgh, GB | 9 |
| Frankfurt am Main | 8 |
| San Sebastián, ES | 8 |
| Uniwersytet Śląski w Katowicachlocation not on record | 8 |
| CASlocation not on record | 8 |
| Yangling, CN | 8 |
| Salamanca, ES | 8 |
| West Virginia Wesleyan Collegelocation not on record | 8 |
| BIO-UNIPIlocation not on record | 8 |
| LfUlocation not on record | 7 |
| DBF-NHMDlocation not on record | 7 |
| South Kensington, GB | 7 |
| GINRlocation not on record | 7 |
| Royal Botanic Garden Edinburghlocation not on record | 7 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 7 |
| GJOlocation not on record | 7 |
| Whitehorse, CA | 7 |
| Ashland, US | 6 |
| Copenhagen, DK | 6 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 6 |
| Wlocation not on record | 6 |
| Tempe, US | 6 |
| Tacoma, US | 6 |
| Bloomington, US | 6 |
| Kew, GB | 6 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 6 |
| Forssa, FI | 5 |
| CJBGlocation not on record | 5 |
| Namur, BE | 5 |
| University of Copenhagen, Natural History Museum of Denmark, Herbarium Clocation not on record | 5 |
| Santa Barbara, US | 5 |
| Cambridge, US | 5 |
| IWEP FEB RASlocation not on record | 5 |
| Portland, US | 5 |
| Denver, US | 4 |
| Uniwersytet Warszawskilocation not on record | 4 |
| Fargo, US | 4 |
| San Diego, US | 4 |
| Philadelphia, US | 4 |
| BDBClocation not on record | 4 |
| KR | 4 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Brisbane, AU | 3 |
| Bourges, FR | 3 |
| KOMlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Barcelona, ES | 3 |
| Beijing, CN | 3 |
| Institute of the biological problems of the North FEB RASlocation not on record | 3 |
| University of Helsinkilocation not on record | 3 |
| Research Collection of B. A. Bennettlocation not on record | 3 |
| Flagstaff, US | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Provo, US | 3 |
| Columbia, US | 3 |
| Millersville, US | 3 |
| Dekalb, US | 3 |
| Stockholm, SE | 3 |
| Hobart, AU | 3 |
| Saint John, CA | 3 |
| UGentlocation not on record | 3 |
| Philadelphia, US | 3 |
| Berlin, DE | 3 |
| Chiba, JP | 3 |
| Sion, CH | 3 |
| Göteborg, SE | 3 |
| No collectionlocation not on record | 2 |
| CICYTEXlocation not on record | 2 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 2 |
| SNSNMClocation not on record | 2 |
| nbflocation not on record | 2 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 2 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Pamplona, ES | 2 |
| Tsukuba, JP | 2 |
| University of Victorialocation not on record | 2 |
| Boise, US | 2 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 2 |
| Brussel, BE | 2 |
| Durham, US | 2 |
| Davis, US | 2 |
| Servico de Microbiologia e Imunologialocation not on record | 2 |
| Emporia, US | 2 |
| Jiangxi College of Educationlocation not on record | 2 |
| Williamsburg, US | 2 |
| Ypsilanti, US | 2 |
| Tilburg, NL | 2 |
| Jaén, ES | 2 |
| Students On Ice Foundationlocation not on record | 2 |
| GZUlocation not on record | 2 |
| National Museum Waleslocation not on record | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 2 |
| Taipei, TW | 2 |
| Museum of the Rockieslocation not on record | 2 |
| UoB-IBlocation not on record | 2 |
| Xiamen, CN | 2 |
| NMBU:MINAlocation not on record | 1 |
| Fulda, DE | 1 |
| Kunming, CN | 1 |
| JMSlocation not on record | 1 |
| Auckland, NZ | 1 |
| Salvador, BR | 1 |
| SZUlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
| H-Wolflocation not on record | 1 |
| DOI/NPS, Olympic National Parklocation not on record | 1 |
| Alicante, ES | 1 |
| BSBIlocation not on record | 1 |
| Madrid, ES | 1 |
| Bangkok, TH | 1 |
| Logan, US | 1 |
| Guilin, CN | 1 |
| NoColllocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Sant Julià de Lòria, AD | 1 |
| Christchurch, NZ | 1 |
| Pittsburg, US | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| US | 1 |
| Herbarium of South China Botanical Gardenlocation not on record | 1 |
| Los Angeles, US | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Nagatoro-machi, Chichibu-gun, JP | 1 |
| Elocation not on record | 1 |
| Badajoz, ES | 1 |
| Armidale, AU | 1 |
| Natural History Museum Rotterdamlocation not on record | 1 |
| Hudson, US | 1 |
| Granada, ES | 1 |
| The State Museum-Preserve "The Kulikovo pole"location not on record | 1 |
| Gijón, ES | 1 |
| Nanjing, CN | 1 |
| Truckee, US | 1 |
| US | 1 |
| SDFlocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Caldwell, US | 1 |
| Centre for Biodiversity Genomicslocation not on record | 1 |
| Austin, US | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
| Durango, US | 1 |
| Santiago de Compostela, ES | 1 |
| Albuquerque, US | 1 |
| University of Lethbridgelocation not on record | 1 |
| John May Museum of Natural Historylocation not on record | 1 |
| Glarus, CH | 1 |
| Smithfield, AU | 1 |
| Siberian Federal Universitylocation not on record | 1 |
| New Brunswick, US | 1 |
| FLADlocation not on record | 1 |
| Bando, JP | 1 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 1 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 1 |
| Keene State Universitylocation not on record | 1 |
| Dover, US | 1 |
256 institutions · 11 257 of 12 128 vouchered records shown · 822 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA76 detections
Where the DNA of Vaccinium uliginosum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found76
Studies independent surveys2
Countries16
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 76 detections have coordinates
Open the map16 countries0
Mesic Acidic Dwarf Shrub - Lichen Tundratoe slope Dwarf Shrub - Carex rariflora - Sp…Medium Shrub Mesic TundraMoist hillside next to road with Salix spp.,…Racomitrium lanuginosum - Lichen /Dwarf Shru…blanket bog; bedrock
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median9.90 °C 1.80–16.4
Seasonal swing summer↔winter24.1 °C
Max temp (day)12.4 °C 3.90–19.0
Min temp (night)6.30 °C -1.60–13.1
Precipitation82.3 mm/mo 31.4–159
Air humidity63.1 % 56.9–71.3
Moisture balance-2.90 mm/mo -67.6–178
Vapour deficit417 Pa 237–705
Wind speed4.30 m/s 2.30–7.40
Cloud cover52.0 % 38.7–68.4
CHELSA 1981–2010, ~9 km grid, at location & month of 60 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.