Vaccinium myrtillus
speciesAt a glance
Occurrence records905 741
Data sources15
Biological traits64
DNA specimens54
eDNA detections29
Sources15 archives
Databases and archives Vaccinium myrtillus's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility905 741 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics54 specimens↗
NCBIUS National Library of Medicinesequences↗
FooDBThe Metabolomics Innovation Centrecompounds↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources64 traits
Chemical compositionFooDB · LOTUS · NPASS5 781 compounds
Occurrence & distributionGBIF905 741 records
Environmental DNA2 datasets · 4 countries29 detections
DNA & barcodingBOLD · NCBI54 specimens
Genome at a glanceCCDB · GoaT · NCBI704 Mbp
01Narrative
La Myrtille (Vaccinium myrtillus) est une espèce de sous-arbrisseaux de la famille des Éricacées qui produit des fruits également appelés myrtilles, appartenant au groupe des airelles. La Myrtille est un vigoureux sous-arbrisseau vivace et rampant, de 20 à 60 cm, que l'on trouve en Eurasie et en Amérique du Nord et qui forme des fourrés nains en dressant des rameaux serrés aux tiges vertes à section triangulaire.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology24
Fruit length7.2 mm
Fruit length max10 mm
Fruit length min6 mm
Fruit width7.35 mm
Fruit width max10 mm
Fruit width min6 mm
Leaf length19 mm
Leaf length max28 mm
Leaf length min10 mm
Leaf mass4.26 mg
Leaf size62.73 mm²
⚠ sources differ — TRY: 62.73 mm² · LEDA: 72.17 mm² · GIFT: 74.89 mm²
Leaf width max13 mm
Leaf width min6 mm
Plant height0.281 m
⚠ sources differ — GIFT: 0.281 m · LEDA: 0.287 m · TRY: 0.09 m
Plant height generative0.15 m
Plant height max0.5 m
Plant height min0.1 m
Seed length1.26 mm
Seed mass0.288 mg
⚠ sources differ — TRY: 0.288 mg · LEDA: 0.266 mg · GIFT: 16.48 mg
Seed mass max0.4 mg
Seed mass min0.26 mg
Seed volume0.17 mm³
Seed volume max0.17 mm³
Seed volume min0.17 mm³
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
Flowering endJun
Flowering startApr
Life formsubshrub
Life spanperennial
Lifespan years9.5 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formchamaephyte
Reproduction asexualabsent
Seed number168
Self fertilizationabsent
Sex typehermaphrodite
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment13
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean2 350 m
Elevation min2 200 m
Epiphyteterrestrial
Fruit fleshinessfleshy
Fruit typeberry
Growth formshrub
Habitat GIFTarctic, forest, tundra
Mycorrhiza typeericoid
Woodinesswoody
Physiology & chemistry9
Leaf C:N ratio26.15 g/g
Leaf c510 mg/g
Leaf dry-matter content (LDMC)388 mg/g
⚠ sources differ — TRY: 388 mg/g · LEDA: 282 mg/g
Leaf n19.22 mg/g
Leaf p1.38 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)19.87 mm²/mg
⚠ sources differ — TRY: 19.87 mm²/mg · LEDA: 18.34 mm²/mg · GIFT: 20.72 mm²/mg
Wood density597 mg/cm³
Other traits1
Diaspore typegerminule
03Chemical composition5 781 compounds
Compounds documented for Vaccinium myrtillus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
🍽 Used in cookingFruits
Compound class profile5 classes
Anthocyanidins90
Aminoacids82
Cinnamic acids and derivatives78
Glycerophospholipids57
Flavonols30
Documented compounds5 781 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| Sugars | 14,300 mg/100g | FooDB | |
| Sucrose | 14,300 mg/100 g | FooDB | |
| Chinese tannin | 13,000 mg/100g | FooDB | |
| D-Fructose | 3,800 mg/100g | FooDB | |
| (-)-Quinic acid | 3,500 mg/100g | FooDB | |
| beta-D-Glucopyranose | 2,960 mg/100g | FooDB | |
| Arbutin | 1,500 mg/100g | FooDB | |
| Potassium | 473 mg/100g | FooDB | |
| Ursolic acid | 250 mg/100g | FooDB |
05DNA & barcoding54 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Vaccinium myrtillus has left across the world's sequence archives.
At a glance
DNA specimens54
Marker genes6
GenBank sequences9
eDNA detections29
Countries6
The DNA barcodea real sequence read deposited for this species
CGGCAACGGATATCTCGGCTCTTGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAGAATCCCGTGAACCATCGAG …
Vaccinium myrtillus isolate 95 5.8S ribosomal RNA gene, partial sequence; and internal transcribed spacer 2, complete sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL2★rbcLa★ITS7★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Vaccinium myrtillus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size704 160 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Vaccinium myrtillus0.70 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 24 n = 12
Ploidydiploid inferred
Chromosome records20–242n range24median24mode30records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2428×GoaT · DTOL Flowering Plants Estimates Kew · CCDB · slov-fl · CCDB · brit-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
CCDB · slov-fl — Mičieta K., 1982: Zytotaxonomischer Beitrag zur Flora des Javorníky-Gebirges II. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 29: 55-61.
CCDB · brit-fl — Rutland, J.P. New Phytol. 40: 210-214 (1941)
CCDB · brit-fl — Hedberg, I., Hedberg, O. Bot. Not. 114: 397-399 (1961)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=2453
CCDB · fl-europaea — I. & 0. Hedberg, 1961
CCDB · ipcn-api-dl — Laane, M. M. & T. Lie. 1985. Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7–15.
CCDB · ipcn-api-dl — Arohonka, T. 1982. Chromosome counts of vascular plants of the island Seili in Nauvo, southwestern Finland. Turun Yliopiston Julkaisuja, Sar. A 2, Biol.-Geogr. 3: 1–12.
CCDB · ipcn-api-dl — MacDougall, P. S. & S. P. V. Kloet. 1982. In IOPB chromosome number reports LXXVII. Taxon 31: 772–773.
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Magulaev, A. V. 1984. Cytotaxonomic study in some flowering plants of the North Caucasus. Bot. Zhurn. SSSR 69(4): 511–517.
CCDB · ipcn-api-dl — Pashuk, K. T. 1987. Chromosome numbers in species of subalpine belt of Chernogora (Ukrainian Carpatians). Bot. Zhurn. 72: 1069–1074.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — LAANE, M.M. 1969. Further chromosome studies in Norwegian vascular plants. Blyttia 27: 5-17.
CCDB · book-ipcn67-71 — ROUSI, A. 1966. The use of North-European Vaccinium species in blueberry breeding. Act. Agric. Scand., Suppl. 16: 50-54.
CCDB · book-ipcn67-71 — ROUSI, A. 1967. Cytological observations on some species and hybrids of Vaccinium. Zuchter 36: 352-359.
CCDB · book-ipcn67-71 — LOEVE, A, D. LOEVE, & B.M. KAPOOR. 1971. Cytotaxonomy of a century of Rocky Mountain orophytes. Arctic & Alpine Res. 3: 139-165.
CCDB · book-fedorov — Hagerup 1941a
CCDB · book-fedorov — Rutland 1941
CCDB · book-fedorov — LOve A., Love D. 1956b
CCDB · book-fedorov — Hedberg L., Hedberg 0. 1961
CCDB · book-fedorov — Sorsa V. 1962
CCDB · book-atlas-flowering-plants — Rutland 1941
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
CCDB · CromoCat 2015 — Laane, M. M. & Lie, T. (1985). Fremstilling av kromosompreparater med enkle metoder. Blyttia 1985: 7-15.
CCDB · CromoCat 2015 — MacDougall, P. S. & van der Kloet, S. P. (1982). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports LXXVII]. Taxon 31(4): 772-773.
CCDB · CromoCat 2015 — Pashuk, K. T. (1987). Chromosome number in species of subalpine belt of Chernogora (Ukrainian Carpathians). Bot. Žurn. 72(8): 1069-1074.
CCDB · iapt — IAPT/IOPB Chromosome Data 22
2n 202×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — López Pacheco, M. J., J. I. A. Felpete, A. F. Rodrígues, R. A. Redondo & E. P. García. 2002. Números cromosómicos para la flora española. 810--814. Lagascalia 22: 153–155.
CCDB · CromoCat 2015 — López Pacheco, M. J., Felpete, J. I. A., Rodrígues, A. F., Redondo, R. A. & García, E. P. (2002). Números cromosómicos para la flora española. 810–814 Lagascalia 22: 153–155
n 128×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1963 +1
CCDB · ipcn-api-dl — UOTILA, P. & K. Pellinen. 1985. Chromosome numbers in vascular plants from Finland. Acta Bot. Fenn. 130.
CCDB · ipcn-api-dl — Mĕsíček, J. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · book-ipcn67-71 — ROUSI, A. 1966. The use of North-European Vaccinium species in blueberry breeding. Act. Agric. Scand., Suppl. 16: 50-54.
CCDB · book-ipcn67-71 — ROUSI, A. 1967. Cytological observations on some species and hybrids of Vaccinium. Zuchter 36: 352-359.
CCDB · Cave1963 — So!'sa 1962
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Vander Kloet, S. P. & T. A. Dickinson. (1999). The taxonomy of Vaccinium section Myrtillus (Ericaceae) Brittonia 51(2): 231-254
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
n 241×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Vander Kloet, S. P. & T. A. Dickinson. (1999). The taxonomy of Vaccinium section Myrtillus (Ericaceae) Brittonia 51(2): 231-254
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness96.7% BUSCO
08Occurrence & distribution
Record type905 741 records
Wild obs. + sensor870 163
Museum / vouchered28 587
Cultivated / captive185
Other6 806
Origin
Native25 057
Introduced12
Range
Area of Occupancy AOO751 652 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy57% within 1 km
≤100 m 244 534≤1 km 182 157≤10 km 316 646>10 km 9 277
752 614 georeferenced · 117 549 without coordinates
Open the mapobservation + sensor870 163
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 1 882≤1 km 6 963≤10 km 16 014>10 km 210
25 069 georeferenced · 3 518 without coordinates
Open the institutions mapphysical evidence28 587
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy7% within 1 km
≤1 km 1≤10 km 2>10 km 11
14 georeferenced · 171 without coordinates
Open the mapnot free-living185
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions111 of 213 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 20 820 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 790 |
| Salzburg, AT | 677 |
| BFLlocation not on record | 454 |
| Moscow State Universitylocation not on record | 391 |
| BIO-UNIPIlocation not on record | 319 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 291 |
| LDlocation not on record | 266 |
| Olocation not on record | 221 |
| MeiseBGlocation not on record | 155 |
| Görlitz, DE | 113 |
| Oskarshamn, SE | 107 |
| Oulu, FI | 101 |
| TROMlocation not on record | 95 |
| Missoula, US | 90 |
| SLU Artdatabankenlocation not on record | 88 |
| Trondheim, NO | 86 |
| Garðabær, IS | 81 |
| Karlsruhe, DE | 78 |
| Jyväskylä, FI | 75 |
| MAlocation not on record | 73 |
| Bergen, NO | 70 |
| Entomological Society of Latvialocation not on record | 67 |
| Turku, FI | 67 |
| Tartu, EE | 62 |
| KMNlocation not on record | 54 |
| WTUlocation not on record | 53 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 52 |
| South Kensington, GB | 49 |
| Moscow, US | 47 |
| University of Hamburglocation not on record | 45 |
| Mlocation not on record | 43 |
| Pullman, US | 43 |
| Uniwersytet Warszawskilocation not on record | 42 |
| València, ES | 36 |
| Bronx, US | 36 |
| Bozeman, US | 36 |
| TUR-Alocation not on record | 35 |
| Tallinn, EE | 33 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 32 |
| Kuopio, FI | 31 |
| 30 | |
| Provincia di Livornolocation not on record | 29 |
| BDBClocation not on record | 25 |
| Albuquerque, US | 24 |
| Vitoria, ES | 23 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 22 |
| San Sebastián, ES | 21 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 20 |
| Paris, FR | 19 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 19 |
| CJBGlocation not on record | 19 |
| Kandalaksha State Nature Reservelocation not on record | 18 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 18 |
| Wuzhou, CN | 18 |
| Voronezh State Universitylocation not on record | 18 |
| CICYTEXlocation not on record | 18 |
| BClocation not on record | 17 |
| Corvallis, US | 16 |
| Rocky Mountain Biological Laboratorylocation not on record | 16 |
| Salamanca, ES | 16 |
| Denver, US | 16 |
| Bern, CH | 15 |
| Santiago de Compostela, ES | 15 |
| Barcelona, ES | 15 |
| Madrid, ES | 14 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 13 |
| Porvoo, FI | 13 |
| College of the Atlantic, Museumlocation not on record | 12 |
| Helsinki, FI | 12 |
| Claremont, US | 12 |
| Uppsala, SE | 12 |
| LfUlocation not on record | 12 |
| Wlocation not on record | 11 |
| Fort Worth, US | 11 |
| nbflocation not on record | 11 |
| Saint Louis, US | 10 |
| Stockholm, SE | 10 |
| Bourges, FR | 10 |
| Flagstaff, US | 10 |
| Berlin, DE | 10 |
| Rovaniemi, FI | 10 |
| University of Alberta Museumslocation not on record | 9 |
| BSBIlocation not on record | 9 |
| Frankfurt am Main | 8 |
| Pocatello, US | 8 |
| GZUlocation not on record | 7 |
| Logan, US | 7 |
| Victoria, CA | 7 |
| Madison, US | 7 |
| UGentlocation not on record | 7 |
| Pamplona, ES | 7 |
| Dresden, DE | 7 |
| Tula State Universitylocation not on record | 6 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 6 |
| Natural History Museum Rotterdamlocation not on record | 6 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 6 |
| Göteborg, SE | 6 |
| BRNUlocation not on record | 6 |
| Tilburg, NL | 6 |
| University of Lethbridgelocation not on record | 6 |
| Porrentruy, CH | 6 |
| Wellington, NZ | 5 |
| NTNU University Museum, Department of Natural Historylocation not on record | 5 |
| Glarus, CH | 5 |
| Kew, GB | 5 |
| Hobart, AU | 5 |
| ASUlocation not on record | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Philadelphia, US | 5 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 5 |
| Frauenfeld, CH | 4 |
| Dekalb, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| WNNUlocation not on record | 4 |
| SZUlocation not on record | 4 |
| Boise, US | 4 |
| Orem, US | 4 |
| Beijing, CN | 4 |
| Xiamen, CN | 4 |
| GJOlocation not on record | 4 |
| Acadia Universitylocation not on record | 3 |
| National Museum Waleslocation not on record | 3 |
| Alicante, ES | 3 |
| DBF-NHMDlocation not on record | 3 |
| DOI/NPS, Greenbelt Parklocation not on record | 3 |
| Namur, BE | 3 |
| Muséum Henri Lecoqlocation not on record | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| Bangkok, TH | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Chongqing Museumlocation not on record | 3 |
| Podgorica, ME | 3 |
| Adam Mickiewicz University in Poznańlocation not on record | 3 |
| UoB-IBlocation not on record | 3 |
| PrivatHerblocation not on record | 3 |
| IWEP FEB RASlocation not on record | 3 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 3 |
| Granada, ES | 3 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 3 |
| Tromso University Museumlocation not on record | 3 |
| Vancouver, CA | 3 |
| University of Stellenboschlocation not on record | 3 |
| Riverside, US | 3 |
| Edinburgh, GB | 2 |
| H-Wolflocation not on record | 2 |
| Phoenix, US | 2 |
| Badajoz, ES | 2 |
| Chadron, US | 2 |
| Museo Achille Folettolocation not on record | 2 |
| Pamplona, ES | 2 |
| Christchurch, NZ | 2 |
| Zürich, CH | 2 |
| Madrid, ES | 2 |
| SNSNMClocation not on record | 2 |
| Durango, US | 2 |
| NMBU:MINAlocation not on record | 2 |
| Boumlocation not on record | 2 |
| Sion, CH | 2 |
| Arcata, US | 2 |
| Columbia, US | 2 |
| ISAlocation not on record | 2 |
| Sant Julià de Lòria, AD | 2 |
| Ivano-Frankove, UA | 2 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| Mississippi State, US | 1 |
| Santa Barbara, US | 1 |
| San Diego, US | 1 |
| Córdoba, ES | 1 |
| Monastir, TN | 1 |
| PRClocation not on record | 1 |
| Philadelphia, US | 1 |
| USFSlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| IPE-CSIClocation not on record | 1 |
| Forssa, FI | 1 |
| St. Paul, US | 1 |
| Brookings, US | 1 |
| Metsähallituslocation not on record | 1 |
| Firenze, IT | 1 |
| JBCLMlocation not on record | 1 |
| Provo, US | 1 |
| Caldwell, US | 1 |
| San Angelo, US | 1 |
| Fulda, DE | 1 |
| FLADlocation not on record | 1 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 1 |
| NoColllocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| Lincoln, US | 1 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 1 |
| Pittsburg, US | 1 |
| Bend, US | 1 |
| Rotorua, NZ | 1 |
| Universidad Nacional de Colombia (UNAL)location not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| EL PASO, US | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Central Botanical Gardenlocation not on record | 1 |
| Zürich, CH | 1 |
| Tacoma, US | 1 |
| Université Lavallocation not on record | 1 |
| Durham, US | 1 |
| Museum of the Rockieslocation not on record | 1 |
| OLAlocation not on record | 1 |
| Royal Botanic Garden Edinburghlocation not on record | 1 |
| US | 1 |
| Burlington, US | 1 |
| Emporia, US | 1 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 1 |
| Uniwersytet Opolskilocation not on record | 1 |
| Museo Entomologico de Leonlocation not on record | 1 |
213 institutions · 27 344 of 28 587 vouchered records shown · 1 091 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Vaccinium myrtillus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys2
Countries4
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map4 countries0
Bared and revegetating morainic ground on si…on boulder in steep gorge in semi-natural wo…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median11.4 °C 8.60–15.7
Seasonal swing summer↔winter15.3 °C
Max temp (day)12.9 °C 10.5–19.7
Min temp (night)8.70 °C 3.70–11.1
Precipitation83.1 mm/mo 60.0–128
Air humidity63.6 % 60.2–65.9
Moisture balance-7.00 mm/mo -38.7–31.2
Vapour deficit482 Pa 407–704
Wind speed3.20 m/s 2.00–4.60
Cloud cover48.8 % 40.0–60.1
CHELSA 1981–2010, ~9 km grid, at location & month of 17 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.