Ustilago tritici

(Bjerk.) Rostr. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Ustilaginomycetes/Ustilaginales/Ustilaginaceae/Ustilago

At a glance

Occurrence records1 066

Data sources9

Biological traits0

DNA specimens40

eDNA detections40

Sources9 archives

Databases and archives Ustilago tritici's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 066 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI40 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics40 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 066 records

Environmental DNA1 datasets · 0 countries40 detections

DNA & barcodingBOLD · NCBI40 specimens

Genome at a glanceGoaT · NCBI≈22 Mbp

01Narrative

Tilletia caries est une espèce de champignons basidiomycètes de la famille des Tilletiaceae, responsable de carie sur blé. Depuis les années 1950, cette maladie est bien maitrisée grâce au contrôle et aux traitements des semences, mais elle est en recrudescence en agriculture biologique. Ce fléau, qui causait des pertes importantes aux paysans à la fin du XVIIIe siècle, a été étudié à cette époque, en particulier par Bénédict Prévost qui, au chaulage préconisé par Mathieu Tillet dès 1755 devant l'Académie de Bordeaux, suggéra d'ajouter le sulfatage. Ses travaux furent néanmoins marginalisés par l'Institut de France et en particulier par le rapporteur Henri-Alexandre Tessier. Il faudra attendre le milieu du XIXe siècle pour que ce procédé soit largement adopté.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding40 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ustilago tritici has left across the world's sequence archives.

At a glance

DNA specimens40

Marker genes2

GenBank sequences10

eDNA detections40

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV827747.1 ↗693 bpIndia · 2019

ACGT

GGGGTTATTATTAAACCTTTTTTTCGAGGTGTGGCTCGCACCTGTCCAACTAAACTTGAGCTACCTTTTTTCAACACGGTTGCATCGGTC …

Ustilago tritici isolate WLS-HZ-19-132 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Ustilago tritici carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈21 998 623 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

THIS GENOME Ustilago tritici0.02 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

Completeness98.9% BUSCO

08Occurrence & distribution

Record type1 066 records

Wild obs. + sensor80

Museum / vouchered969

Other17

Origin

Native2

Range

Area of Occupancy AOO2 576 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy19% within 1 km

≤1 km 15≤10 km 63

78 georeferenced · 2 without coordinates

Open the mapobservation + sensor80

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy10% within 1 km

≤100 m 1≤1 km 68≤10 km 514>10 km 120

703 georeferenced · 266 without coordinates

Open the institutions mapphysical evidence969

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 39 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
ILLSlocation not on record	260
Bernard Price Institute for Palaeontological Researchlocation not on record	249
DPIlocation not on record	78
Bronx, US	60
Lincoln, US	43
Catholic University of Pekinglocation not on record	42
Pullman, US	31
Madison, US	21
Auckland, NZ	21
Karlsruhe, DE	20
LDlocation not on record	16
Uppsala, SE	14
Helsinki, FI	13
Champaign, US	13
Clemson, US	11
TENN-Flocation not on record	8
Chapel Hill, US	7
CA	6
FLASlocation not on record	6
PHlocation not on record	5
BDBClocation not on record	5
Görlitz, DE	4
Stockholm, SE	4
MeiseBGlocation not on record	4
Brown Universitylocation not on record	4
McWane Science Centerlocation not on record	3
Kew, GB	3
Institute of Botany of the Academy of Science of the Republic of Uzbekistanlocation not on record	2
Kensington, AU	2
Museo Entomologico de Leonlocation not on record	2
Canberra, AU	2
MAlocation not on record	2
WU-MYClocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Baton Rouge, US	1
Ann Arbor, US	1
Laramie, US	1
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	1
Cincinnati, US	1

39 institutions · 968 of 969 vouchered records shown · 1 without an institution code

09Environmental DNA40 detections

Where the DNA of Ustilago tritici was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found40

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 40 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ustilago tritici

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 066 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions21 of 39 geolocated

Signal

Where its DNA was found

How strong is each trace?

Record type1 066 records