Urtica dioica
speciesAt a glance
Occurrence records1 831 420
Data sources11
Biological traits70
DNA specimens96
eDNA detections82
Sources11 archives
Databases and archives Urtica dioica's data was compiled from.
GBIFGlobal Biodiversity Information Facility1 831 403 records↗
OBISOcean Biodiversity Information System7 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI82 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics96 specimens↗
NCBIUS National Library of Medicinesequences↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
Traits & measurements5 literature sources70 traits
Chemical compositionNPASS84 compounds
Occurrence & distributionGBIF · OBIS · PBDB1 831 420 records
Environmental DNA5 datasets · 20 countries82 detections
DNA & barcodingBOLD · NCBI96 specimens
Genome at a glanceGoaT · NCBI1.2 Gbp
Deep timePBDB10 fossils
02Traits & measurements
SourcesGIFTAusTraitsLEDATRYWCVP
Size & morphology27
Fruit length1.25 mm
⚠ sources differ — AusTraits: 1.25 mm · GIFT: 2.8 mm
Fruit length max1.2 mm
Fruit length min1 mm
Inflorescence length max8 cm
Inflorescence length min2 cm
Leaf length120 mm
⚠ sources differ — AusTraits: 120 mm · GIFT: 70 mm
Leaf length max183 mm
Leaf length min30 mm
Leaf mass101 mg
Leaf size1 939 mm²
⚠ sources differ — TRY: 1 939 mm² · LEDA: 3 842 mm² · GIFT: 3 842 mm²
Leaf width40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 32.5 mm
Leaf width max60 mm
Leaf width min10 mm
Petiole length2.75 cm
Plant height0.987 m
⚠ sources differ — GIFT: 0.987 m · AusTraits: 1.5 m · LEDA: 0.9 m · TRY: 0.976 m
Plant height generative0.998 m
Plant height max3 m
Plant height min0.3 m
Seed length1.21 mm
⚠ sources differ — TRY: 1.21 mm · GIFT: 1.3 mm
Seed length max1.3 mm
Seed length min1.3 mm
Seed mass0.151 mg
⚠ sources differ — TRY: 0.151 mg · LEDA: 0.177 mg · GIFT: 0.092 mg
Seed mass max0 mg
Seed mass min0 mg
Seed volume0.31 mm³
Seed volume max0.37 mm³
Seed volume min0.27 mm³
Life cycle & reproduction15
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typeanimal
⚠ sources differ — LEDA: epizoochor · GIFT: anemochorous
Flowering endOct
Flowering startMay
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan years2 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formhemicryptophyte
Reproduction asexualabsent
Seed number3 560
Self fertilizationabsent
Sex typedioecious
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment15
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max5 000 m
Elevation mean3 225 m
Elevation min0 m
Epiphyteterrestrial
Fruit fleshinessdry
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, forest, old fields, shrubberies
Leaf compoundnesssimple
Leaf shapelanceolate ovate
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry10
Leaf C:N ratio13.27 g/g
Leaf c400 mg/g
Leaf dry-matter content (LDMC)263 mg/g
⚠ sources differ — TRY: 263 mg/g · LEDA: 212 mg/g
Leaf n40.9 mg/g
Leaf p4.24 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Seed longevity index0.5
Specific leaf area (SLA)26.62 mm²/mg
⚠ sources differ — TRY: 26.62 mm²/mg · LEDA: 26.95 mm²/mg · GIFT: 28.48 mm²/mg
Wood density223 mg/cm³
Other traits1
Diaspore typeone-seeded generative dispersule
03Chemical composition84 compounds
Compounds documented for Urtica dioica across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cinnamic acids and derivatives9
Dicarboxylic acids3
Flavonols3
Shikimic acids and derivatives $ Simple phenolic acids2
Aminoacids2
Documented compounds84 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Neoolivil | present | NPASS | |
| (1R,3S,4S,5S)-3-((E)-3-(3,4-Dihydroxyphenyl)Acryloyloxy)-1,4,5-Trihydroxycyclohexanecarboxylic Acid | present | NPASS | |
| (4aS,6aS,7S,11aR,11bS)-1,2,3,4,4a,5,6,7,8,11,11a,11b-Dodecahydro-7-hydroxy-4,4,11b-trimethyl-6aH-cyclohepta(a)naphthalene-6a,9-dicarboxaldehyde | present | NPASS | |
| (all-E)-Violaxanthin | present | NPASS | |
| (R)-Citronellal | present | NPASS | |
| 1H-Indole-3-carboxaldehyde | present | NPASS | |
| 3-Pentanol | present | NPASS | |
| 4-Hydroxybenzaldehyde | present | NPASS | |
| 4-Hydroxybenzyl Alcohol | present | NPASS | |
| 4-Hydroxybenzylamine | present | NPASS |
05DNA & barcoding96 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urtica dioica has left across the world's sequence archives.
At a glance
DNA specimens96
Marker genes10
GenBank sequences10
eDNA detections82
Countries20
The DNA barcodea real sequence read deposited for this species
GTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTAGGCCGAGGGCACGTCTGCCTGGGCGTCACGCACCGTTGCCCCCCA …
Urtica dioica subsp. dioica voucher PLT.0554 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL3★rbcLa★trnL-F★ITS7★ITS1★ITS2atpF-atpHrpoC1trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceGoaT · NCBI
The complete instruction manual Urtica dioica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size1 202 940 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Urtica dioica1.2 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 52 n = 26
Ploidy4× tetraploid · measured
Chromosome records52–522n range52median52mode2records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 522×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
tetraploid1×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness91.9% BUSCO
07Deep time16–0 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range16–0 Ma Miocene → Holocene
Dated fossil finds10
StatusStill living record runs to the present
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Urtica dioica. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type1 831 420 records
Wild obs. + sensor1 793 744
Museum / vouchered31 205
Cultivated / captive228
Fossil17
Other6 226
Origin
Native67 917
Introduced262
Range
Area of Occupancy AOO1 057 056 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy54% within 1 km
≤100 m 413 643≤1 km 339 430≤10 km 641 224>10 km 8 337
1 402 634 georeferenced · 391 110 without coordinates
Open the mapobservation + sensor1 793 744
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy33% within 1 km
≤100 m 1 404≤1 km 7 035≤10 km 16 636>10 km 515
25 590 georeferenced · 5 615 without coordinates
Open the institutions mapphysical evidence31 205
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy2% within 1 km
≤100 m 1≤1 km 1≤10 km 68>10 km 14
84 georeferenced · 144 without coordinates
Open the mapnot free-living228
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions188 of 368 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 21 630 |
| BFLlocation not on record | 804 |
| BIO-UNIPIlocation not on record | 675 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 417 |
| LDlocation not on record | 404 |
| Salzburg, AT | 370 |
| Moscow State Universitylocation not on record | 311 |
| Oulu, FI | 260 |
| Uniwersytet Warszawskilocation not on record | 208 |
| Görlitz, DE | 183 |
| Instytut Ochrony Przyrody Polskiej Akademii Nauklocation not on record | 183 |
| Helsinki, FI | 183 |
| Berlin, DE | 169 |
| Karlsruhe, DE | 142 |
| Philadelphia, US | 119 |
| Jyväskylä, FI | 108 |
| Turku, FI | 103 |
| Oskarshamn, SE | 100 |
| South Kensington, GB | 99 |
| MeiseBGlocation not on record | 92 |
| PRClocation not on record | 81 |
| Adam Mickiewicz University in Poznańlocation not on record | 80 |
| Tartu, EE | 77 |
| Chongqing Museumlocation not on record | 74 |
| Entomological Society of Latvialocation not on record | 71 |
| MAlocation not on record | 70 |
| València, ES | 65 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 63 |
| Ann Arbor, US | 62 |
| IFR-DNFlocation not on record | 56 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 54 |
| Kuopio, FI | 53 |
| Museo Entomologico de Leonlocation not on record | 52 |
| KMNlocation not on record | 49 |
| Uniwersytet Opolskilocation not on record | 47 |
| Uniwersytet Marii Curie-Skłodowskiejlocation not on record | 47 |
| Boise, US | 47 |
| BRNUlocation not on record | 43 |
| Denver, US | 42 |
| Mlocation not on record | 41 |
| Beijing, CN | 40 |
| Riverside, US | 39 |
| Pamplona, ES | 39 |
| Green Bay, US | 37 |
| University of Stellenboschlocation not on record | 36 |
| Wlocation not on record | 36 |
| Irkutsk State Universitylocation not on record | 36 |
| Provincia di Livornolocation not on record | 36 |
| BDBClocation not on record | 32 |
| Bern, CH | 31 |
| TUR-Alocation not on record | 31 |
| Saint Louis, US | 30 |
| GMBAlocation not on record | 28 |
| UniKSlocation not on record | 27 |
| SLU Artdatabankenlocation not on record | 26 |
| National Institute of Biological Resourceslocation not on record | 26 |
| Bronx, US | 26 |
| Santa Barbara, US | 26 |
| Barcelona, ES | 25 |
| Madison, US | 24 |
| College of the Atlantic, Museumlocation not on record | 23 |
| Millersville, US | 23 |
| Olocation not on record | 22 |
| Salamanca, ES | 22 |
| Porvoo, FI | 22 |
| UGentlocation not on record | 21 |
| BClocation not on record | 21 |
| ISAlocation not on record | 21 |
| Pocatello, US | 20 |
| Vitoria, ES | 20 |
| Madrid, ES | 20 |
| Kandalaksha State Nature Reservelocation not on record | 19 |
| Moscow, US | 18 |
| CICYTEXlocation not on record | 17 |
| Pretoria, ZA | 17 |
| Uppsala, SE | 17 |
| Frankfurt am Main | 17 |
| Urumqi, CN | 16 |
| Logan, US | 15 |
| Urumqi, CN | 15 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 15 |
| Pullman, US | 15 |
| Granada, ES | 15 |
| TROMlocation not on record | 14 |
| Christchurch, NZ | 14 |
| Québec, CA | 14 |
| Montréal, CA | 14 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 14 |
| Acadia Universitylocation not on record | 13 |
| Whitewater, US | 13 |
| Université Lavallocation not on record | 13 |
| DOI/NPS, Greenbelt Parklocation not on record | 13 |
| Trondheim, NO | 13 |
| Natural History Museum Rotterdamlocation not on record | 13 |
| Flagstaff, US | 12 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 12 |
| Spearfish, US | 12 |
| McWane Science Centerlocation not on record | 12 |
| Badajoz, ES | 11 |
| H-Schuhwlocation not on record | 11 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 11 |
| Durango, MX | 11 |
| Tallinn, EE | 11 |
| Kunming, CN | 11 |
| CJBGlocation not on record | 11 |
| Williamsburg, US | 10 |
| Claremont, US | 10 |
| San Luis Obispo, US | 10 |
| Staten Island, US | 10 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 9 |
| Porrentruy, CH | 9 |
| Zürich, CH | 9 |
| St. Paul, US | 9 |
| Tula State Universitylocation not on record | 9 |
| Victoria, CA | 9 |
| Vancouver, CA | 8 |
| WTUlocation not on record | 8 |
| Provo, US | 8 |
| Allentown, US | 8 |
| Brookings, US | 7 |
| Santa Cruz, US | 7 |
| University of Lethbridgelocation not on record | 7 |
| Mexico City, MX | 7 |
| Rovaniemi, FI | 7 |
| Philadelphia, US | 7 |
| Phoenix, US | 7 |
| Kew, GB | 7 |
| DASSHlocation not on record | 7 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 7 |
| Frauenfeld, CH | 6 |
| Winterthur, CH | 6 |
| Toronto, CA | 6 |
| BSBIlocation not on record | 6 |
| Phyletisches Museum Jenalocation not on record | 6 |
| Valparaiso, CL | 6 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 6 |
| Nanjing, CN | 6 |
| Wellington, NZ | 6 |
| Paris, FR | 6 |
| Zürich, CH | 6 |
| Pittsburg, US | 6 |
| Grand Junction, US | 5 |
| New Haven, US | 5 |
| Hudson, US | 5 |
| CASlocation not on record | 5 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 5 |
| Dekalb, US | 5 |
| Lanzhou, CN | 5 |
| Yangling, CN | 5 |
| GZUlocation not on record | 5 |
| Tilburg, NL | 5 |
| Pamplona, ES | 5 |
| Natural History Museum, Tribhuvan Universitylocation not on record | 5 |
| Bozeman, US | 5 |
| UTPLlocation not on record | 5 |
| Dresden, DE | 4 |
| NMBU:MINAlocation not on record | 4 |
| Macomb, US | 4 |
| Puebla, MX | 4 |
| National Museum Waleslocation not on record | 4 |
| Bangkok, TH | 4 |
| GJOlocation not on record | 4 |
| Glarus, CH | 4 |
| Cambridge, US | 4 |
| Banyoles, ES | 4 |
| ASUlocation not on record | 4 |
| Cheney, US | 4 |
| Ciudad de México, MX | 4 |
| Centro de Investigación en Biodiversidad y Conservación, Universidad Autónoma del Estado de Moreloslocation not on record | 4 |
| Tacoma, US | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Turlock, US | 4 |
| Tampa, US | 4 |
| Blumenau, BR | 4 |
| Durham, US | 4 |
| Kathmandu, NP | 4 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 4 |
| Weber State Universitylocation not on record | 4 |
| Canadian Department of Agriculturelocation not on record | 4 |
| Lord Fairfax Community Collegelocation not on record | 3 |
| SZUlocation not on record | 3 |
| Oswego, US | 3 |
| University of British Columbia, Herbariumlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| Austin, US | 3 |
| Clemson, US | 3 |
| Richmond, US | 3 |
| WINlocation not on record | 3 |
| Universidad Nacional de Colombia (UNAL)location not on record | 3 |
| Kirksville, US | 3 |
| Naturalis Biodiversity Centerlocation not on record | 3 |
| SWlocation not on record | 3 |
| Bend, US | 3 |
| Loja, EC | 3 |
| Keene State Universitylocation not on record | 3 |
| Eastern Nevada Landscape Coalitionlocation not on record | 3 |
| Universidad de Nariño (UdeNar)location not on record | 3 |
| Criciúma, BR | 3 |
| Bourges, FR | 3 |
| College Park, US | 3 |
| Sagamihara, JP | 3 |
| UChlocation not on record | 3 |
| Durango, US | 3 |
| Fulda, DE | 3 |
| Dehra Dun, IN | 3 |
| Coimbra, PT | 3 |
| Mexico City, MX | 3 |
| IWEP FEB RASlocation not on record | 3 |
| UNESClocation not on record | 3 |
| Mount Annan, AU | 3 |
| Palmerston North, NZ | 2 |
| Universidad Católica de Oriente (UCO)location not on record | 2 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 2 |
| University of Guelph, OAC Herbariumlocation not on record | 2 |
| Hobart, AU | 2 |
| Bergen, NO | 2 |
| BGBMlocation not on record | 2 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 2 |
| Davenport, US | 2 |
| Fort Worth, US | 2 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 2 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 2 |
| Los Angeles, US | 2 |
| Meguro Parasitological Museumlocation not on record | 2 |
| Santiago de Compostela, ES | 2 |
| Science Museum of Minnesotalocation not on record | 2 |
| Corrientes, AR | 2 |
| DBF-NHMDlocation not on record | 2 |
| Valdosta State Universitylocation not on record | 2 |
| University of New Hampshirelocation not on record | 2 |
| San Diego, US | 2 |
| Córdoba, AR | 2 |
| Riobamba, EC | 2 |
| Forssa, FI | 2 |
| Corvallis, US | 2 |
| La Paz, BO | 2 |
| San Angelo, US | 2 |
| Davis, US | 2 |
| Institute of the biological problems of the North FEB RASlocation not on record | 2 |
| nbflocation not on record | 2 |
| Bandelier National Monumentlocation not on record | 2 |
| New Brunswick, US | 2 |
| Portland, US | 2 |
| Viña del Mar, CL | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Ensenada, MX | 2 |
| LfUlocation not on record | 2 |
| IDElocation not on record | 2 |
| Albuquerque, US | 2 |
| OLAlocation not on record | 2 |
| Stockholm, SE | 2 |
| FLADlocation not on record | 2 |
| Nijmegen, NL | 2 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 2 |
| Instituto de Investigaciones Biológicas, Universidad Veracruzana, Región Xalapalocation not on record | 2 |
| Waverly, US | 2 |
| Bothell, US | 2 |
| Irvine, US | 1 |
| Fredericksburg, US | 1 |
| IEBlocation not on record | 1 |
| US | 1 |
| Ojo, NG | 1 |
| Royal Botanical Gardenslocation not on record | 1 |
| Dover, US | 1 |
| University of Agriculture, Faisalabadlocation not on record | 1 |
| UFOPlocation not on record | 1 |
| Istituto Agrario Castelnuovolocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| Churchill Northern Studies Centrelocation not on record | 1 |
| Research Collection of B. A. Bennettlocation not on record | 1 |
| Mount Pleasant, US | 1 |
| University of Genevalocation not on record | 1 |
| Prioksko-Terrasnyi Biosphere Reservelocation not on record | 1 |
| UFESlocation not on record | 1 |
| Baroda, IN | 1 |
| Royal Botanic Gardens, Kewlocation not on record | 1 |
| AASlocation not on record | 1 |
| Chengdu, CN | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Elocation not on record | 1 |
| THIMlocation not on record | 1 |
| Giardini Botanici Hanburylocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| PUC-RIOlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Tibet Plateau Institute of Biologylocation not on record | 1 |
| LPMMBHlocation not on record | 1 |
| AUAlocation not on record | 1 |
| Universidad de Caldas (UCaldas)location not on record | 1 |
| Bloomington, US | 1 |
| Göteborg, SE | 1 |
| Chapel Hill, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| UNICAMPlocation not on record | 1 |
| Columbia, US | 1 |
| ROM020location not on record | 1 |
| ZRC-SAZUlocation not on record | 1 |
| Sion, CH | 1 |
| Brisbane, AU | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Bureau of Land Managementlocation not on record | 1 |
| LINUlocation not on record | 1 |
| Pontificia Universidad Javeriana (PUJ)location not on record | 1 |
| Federal University of Espírito Santolocation not on record | 1 |
| Missoula, US | 1 |
| CEPLAClocation not on record | 1 |
| Cambridge, US | 1 |
| FUVATESlocation not on record | 1 |
| Departamento de Sistematica e Ecologialocation not on record | 1 |
| Edinburgh, GB | 1 |
| UNESP-FCAlocation not on record | 1 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 1 |
| Pacific Lutheran Universitylocation not on record | 1 |
| Porto Velho, BR | 1 |
| UFRRJlocation not on record | 1 |
| H-Wolflocation not on record | 1 |
| USFS/BHSClocation not on record | 1 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 1 |
| JBRJlocation not on record | 1 |
| Chengdu, CN | 1 |
| Bureau of Land Management, Caliente Field Officelocation not on record | 1 |
| Caldwell, US | 1 |
| Hazara Universitylocation not on record | 1 |
| La Paz, MX | 1 |
| US | 1 |
| Chapingo, MX | 1 |
| AZE014location not on record | 1 |
| Henderson, US | 1 |
| ESP004location not on record | 1 |
| DOI/FWS, Kenai National Wildlife Refugelocation not on record | 1 |
| San Isidro, AR | 1 |
| Herb. BBGlocation not on record | 1 |
| Museo Achille Folettolocation not on record | 1 |
| UFPElocation not on record | 1 |
| Wuzhou, CN | 1 |
| Durban, ZA | 1 |
| Sevilla, ES | 1 |
| Decorah, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| CONCOLlocation not on record | 1 |
| Philadelphia, US | 1 |
| Universidad de Antioquia (UdeA)location not on record | 1 |
| Due West, US | 1 |
| TAFORI-LSRClocation not on record | 1 |
| SEFlocation not on record | 1 |
| Musée des Confluenceslocation not on record | 1 |
| Washington, US | 1 |
| European Distributed Institute of Taxonomy (EDIT)location not on record | 1 |
| Burlington, US | 1 |
| US | 1 |
| Altos de Pipe, VE | 1 |
| Xiamen, CN | 1 |
| Pelotas, BR | 1 |
| H-AkrKGlocation not on record | 1 |
| Fargo, US | 1 |
| Alicante, ES | 1 |
| VALElocation not on record | 1 |
| Namur, BE | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Qarshi Botanical Gardenlocation not on record | 1 |
| Monastir, TN | 1 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 1 |
| Northridge, US | 1 |
| CMULlocation not on record | 1 |
| UIBlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| Instituto de Ecología Aplicada, Universidad Autónoma de Tamaulipaslocation not on record | 1 |
| Yellowstone National Park Herbariumlocation not on record | 1 |
368 institutions · 29 801 of 31 205 vouchered records shown · 1 037 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA82 detections
Where the DNA of Urtica dioica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found82
Studies independent surveys5
Countries20
Verifiable raw sequence linked20
Signal confidence: moderateweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 82 detections have coordinates
Open the map20 countries0
on a wood pile.Burned in 2007. Huge seep that is on a slope…On beaver dam and along creek in rich organi…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median14.4 °C 7.30–17.2
Seasonal swing summer↔winter17.0 °C
Max temp (day)17.4 °C 9.20–22.2
Min temp (night)10.5 °C 3.10–14.5
Precipitation72.0 mm/mo 33.9–114
Air humidity61.8 % 49.0–64.2
Moisture balance-15.7 mm/mo
Vapour deficit661 Pa 404–864
Wind speed4.10 m/s
Cloud cover43.8 % 28.2–52.3
CHELSA 1981–2010, ~9 km grid, at location & month of 65 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.