Uromycladium tepperianum

(Sacc.) McAlpine · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Pucciniomycetes/Pucciniales/Uromycladiaceae/Uromycladium

At a glance

Occurrence records674

Data sources8

Biological traits0

DNA specimens9

eDNA detections9

Sources8 archives

Databases and archives Uromycladium tepperianum's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility674 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI9 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF674 records

Environmental DNA2 datasets · 1 countries9 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Uromycladium tepperianum is a rust fungus that infects over 100 species of Acacia and related genera including Paraserianthes in Australia, south-east Asia, the south Pacific and New Zealand.Morris, M.J. (1987). Biology of the Acacia gall rust, Uromycladium tepperianum. Plant Pathol. 36: 100–106.Shivas, R.G. (1989). Fungal and bacterial diseases of plants in Western Australia. Jour. Royal Soc. West. Aust. 72:1–62.Walker, J. (1983). Pacific mycogeography: deficiencies and irregularities in the distribution of plant parasitic fungi. Aust. Jour. Bot. Suppl. Ser. 10: 89–136.McKenzie, E.H.C. (1998). Rust fungi of New Zealand – an introduction and list of recorded species. N.Z. Jour. Bot. 36: 233–271. The acacia gall rust fungus species Uromycladium tepperianum has been introduced to South Africa as a biological control on the invasive Australian shrub Acacia saligna.Judith H. Myers, Dawn Bazely (2003). Ecology and Control of Introduced Plants. Cambridge University Press. . Uromycladium tepperianum is differentiated from other species of Uromycladium by the presence of three one-celled fertile teliospores on the pedicel.McAlpine, D. (1905). A new genus of Uredineae – Uromycladium. Ann. Mycol. 3: 303–322.Doungsa-ard, C., McTaggart, A.R., Geering, A.D.W., Dalisay, T.U., Ray, J. Shivas, R.G. 2015. Uromycladium falcatarium sp. nov., the cause of gall rust on Paraserianthes falcataria in south-east Asia. Australasian Plant Pathol. 44: 25–30. DOI 10.1007/s13313-014-0301-z

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Uromycladium tepperianum has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes2

GenBank sequences10

eDNA detections9

Countries2

The DNA barcodea real sequence read deposited for this species

ITSKR994775.1 ↗817 bpAustralia

ACGT

CATTGTGGCTCTTGAATATTTTTTTATATTTTTACCCCCCCCACCTTATTTTGGCTCCTTGATGTGGGTTGATTTTATCCTCACAGTTAT …

Uromycladium tepperianum voucher BRIP 59895 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

07Deep time~4.73 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin4.73 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type674 records

Wild obs. + sensor23

Museum / vouchered651

Origin

Native2

Range

Area of Occupancy AOO1 668 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 5>10 km 1

6 georeferenced · 17 without coordinates

Open the mapobservation + sensor23

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 9≤1 km 11≤10 km 25>10 km 2

47 georeferenced · 604 without coordinates

Open the institutions mapphysical evidence651

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
DPIlocation not on record	450
Kensington, AU	153
Auckland, NZ	17
Museo Entomologico de Leonlocation not on record	9
Canberra, AU	6
Bernard Price Institute for Palaeontological Researchlocation not on record	5
Adelaide, AU	5
Hobart, AU	3
Pullman, US	1

9 institutions · 649 of 651 vouchered records shown · 1 without an institution code

09Environmental DNA9 detections

Where the DNA of Uromycladium tepperianum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found9

Studies independent surveys2

Countries1

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 9 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature21.5 °C

Depth0 m

Sediment

1 sample with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.0 °C 20.2–21.7

Seasonal swing summer↔winter13.5 °C

Max temp (day)25.2 °C 22.6–27.8

Min temp (night)16.6 °C 15.3–17.9

Precipitation75.0 mm/mo 27.5–123

Air humidity52.5 % 45.2–59.8

Moisture balance-85.2 mm/mo -131–-39.4

Vapour deficit1,261 Pa 970–1,551

Wind speed4.40 m/s 4.10–4.70

Cloud cover22.8 % 19.0–26.6

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)