Urodeta hibernella

(Staudinger, 1859) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Elachistidae/Urodeta

At a glance

Occurrence records58

Data sources7

Biological traits0

DNA specimens11

eDNA detections15

Sources7 archives

Databases and archives Urodeta hibernella's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility58 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI15 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF58 records

Environmental DNA1 datasets · 4 countries15 detections

DNA & barcodingBOLD11 specimens

01Narrative

Urodeta hibernella is a moth of the family Elachistidae. It is known from France, Corsica and the Iberian Peninsula. Mine The larvae feed on Cistus monspeliensis and Helianthemum. They mine the leaves of their host plant. The mine consists of an elongated, slightly puckered, full depth blotch, without an initial corridor. The frass is concentrated in the lowest part of the mine. After a while, the larvae leave their mine and restart elsewhere. Pupation takes place outside of the mine.bladmineerders.nl

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urodeta hibernella has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections15

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 19 variable positions, in barcode order

34Tmostly conserved

43Tmostly conserved

50Tmostly conserved

58Amostly conserved

103Cmostly conserved

166Amostly conserved

235Cmostly conserved

247Cmostly conserved

346Cvariable

364Cmostly conserved

382Cmostly conserved

397Tmostly conserved

400Cmostly conserved

406Tvariable

424Avariable

589Cvariable

604Tmostly conserved

616Cmostly conserved

637Amostly conserved

AACATTATATTTTATTTTTGGAGTTTGAGCTGGTATATTAGGTACTTCTTTAAGATTATTAATTCGAGCAGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.90%

Haplotypes4

BIN1

Most divergent pair1.1%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Ascalenia vanellasame order10.8%Sciaphila debilianasame order11.1%Panthea giganteasame order11.4%Ymeldia janaesame order11.4%Holocola deloschemasame order11.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type58 records

Wild obs. + sensor27

Museum / vouchered31

Origin

Native4

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 2≤1 km 21≤10 km 4

27 georeferenced

Open the mapobservation + sensor27

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 26>10 km 1

27 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 1 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Helsinki, FI	29

1 institutions · 29 of 31 vouchered records shown · 2 without an institution code

09Environmental DNA15 detections

Where the DNA of Urodeta hibernella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found15

Studies independent surveys1

Countries4

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 15 detections have coordinates

Open the map4 countries0

Cistus ladanifer mattoral

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median17.4 °C 13.0–20.5

Seasonal swing summer↔winter14.1 °C

Max temp (day)18.7 °C 16.6–22.6

Min temp (night)14.2 °C 11.0–18.6

Precipitation48.2 mm/mo 32.7–79.8

Air humidity59.9 % 56.3–63.3

Moisture balance-98.7 mm/mo -131–-44.7

Vapour deficit758 Pa 609–967

Wind speed3.40 m/s 2.70–4.70

Cloud cover38.7 % 36.4–44.0

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)