Urocystis agropyri

(Preuss) A.A.Fisch.Waldh. · species

image placeholder — illustration coming later

Fungi/Basidiomycota/Ustilaginomycetes/Urocystidales/Urocystidaceae/Urocystis

At a glance

Occurrence records1 098

Data sources8

Biological traits0

DNA specimens2

eDNA detections238

Sources8 archives

Databases and archives Urocystis agropyri's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 098 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI238 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 098 records

Environmental DNA6 datasets · 13 countries238 detections

DNA & barcodingBOLD · NCBI2 specimens

01Narrative

Urocystis agropyri is a fungal plant pathogen that causes flag smut on wheat.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urocystis agropyri has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes1

GenBank sequences9

eDNA detections238

Countries13

The DNA barcodea real sequence read deposited for this species

ITSMN947332.1 ↗341 bpIndia

ACGT

TTTGAACAGGGGGGCTGGATCTGTATCCGCCCCCGACCCTTCGATCCACACACACACACCTGTGCACACACAACCATACCCGCCTCGGCG …

Urocystis agropyri isolate FLS49 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS9

fungal barcode

08Occurrence & distribution

Record type1 098 records

Wild obs. + sensor55

Museum / vouchered985

Other58

Range

Area of Occupancy AOO2 288 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy23% within 1 km

≤100 m 8≤1 km 2≤10 km 33

43 georeferenced · 12 without coordinates

Open the mapobservation + sensor55

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 6≤1 km 71≤10 km 393>10 km 85

555 georeferenced · 430 without coordinates

Open the institutions mapphysical evidence985

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions22 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bernard Price Institute for Palaeontological Researchlocation not on record	275
Pullman, US	200
Görlitz, DE	63
Madison, US	56
LDlocation not on record	52
Helsinki, FI	39
Auckland, NZ	35
Karlsruhe, DE	24
Uppsala, SE	22
Catholic University of Pekinglocation not on record	20
DPIlocation not on record	20
Chicago, US	19
Champaign, US	18
Lincoln, US	15
Chapel Hill, US	11
CA	9
St. Paul, US	8
MeiseBGlocation not on record	6
Kew, GB	6
FLASlocation not on record	5
Hobart, AU	4
Stockholm, SE	4
Baton Rouge, US	4
Cincinnati, US	3
ILLSlocation not on record	3
Canberra, AU	3
Museo Entomologico de Leonlocation not on record	2
Brown Universitylocation not on record	2
Grupo Actinomicetales Merida Facultad de Medicinalocation not on record	2
TENN-Flocation not on record	1
Berlin, DE	1
Olocation not on record	1
Institute of Botany of the Academy of Sciences of the Republic of Uzbekistanlocation not on record	1
Université de Montréal Biodiversity Centrelocation not on record	1
Laramie, US	1
Nurata nature reservelocation not on record	1
McWane Science Centerlocation not on record	1
Ann Arbor, US	1

38 institutions · 939 of 985 vouchered records shown · 46 without an institution code

09Environmental DNA238 detections

Where the DNA of Urocystis agropyri was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found238

Studies independent surveys6

Countries13

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 238 detections have coordinates

Open the map13 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Measured at samplingin-field

Temperature15.0 °C 7.00–24.0

pH6.20 4.60–7.00

Conductivity105 µS/cm 21.0–9,572

Organic carbon3.70 % 0.46–5.07

Nitrate-N10.0 mg/kg 1.00–32.0

Phosphorus32.0 mg/kg 2.00–225

Clay20.6 % 5.00–48.0

Sand70.8 % 42.0–91.0

Depth0 m 0–0.2

SoilSodosolFerrosolVertosolTenosolKurosol

41 samples with on-site data · median with range · describes the sample, not the organism

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.7 °C 6.00–17.5

Seasonal swing summer↔winter22.0 °C

Max temp (day)16.6 °C 9.50–21.5

Min temp (night)8.60 °C 3.60–13.4

Precipitation69.6 mm/mo 47.6–92.8

Air humidity60.0 % 56.7–64.0

Moisture balance-25.6 mm/mo -67.3–26.5

Vapour deficit622 Pa 368–803

Wind speed3.80 m/s 2.50–4.30

Cloud cover40.0 % 27.1–48.6

CHELSA 1981–2010, ~9 km grid, at location & month of 230 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Urocystis agropyri

At a glance

Sources8 archives

At a glance

Record type1 098 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions22 of 38 geolocated

Signal

Where its DNA was found

How strong is each trace?

Measured at samplingin-field

Modelled climatemodelled

Record type1 098 records