Urnula padeniana

M.Carbone, Agnello, A.D.Parker & P.Alvarado · species

image placeholder — illustration coming later

Fungi/Ascomycota/Pezizomycetes/Pezizales/Sarcosomataceae/Urnula

At a glance

Occurrence records337

Data sources6

Biological traits0

DNA specimens0

eDNA detections2

Sources6 archives

Databases and archives Urnula padeniana's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility337 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF337 records

Environmental DNA2 datasets · 0 countries2 detections

DNA & barcodingNCBIsequences

01Narrative

Urnula padeniana is a species of cup fungus in the family Sarcosomataceae. It was described as new to science in 2013. It has a rubbery, black fruitbody up to 9 cm in diameter and 7 cm high, with gelatinous flesh. It spores typically measure 25–30 by 11–13 μm. The fungus is found in North America.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding7 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urnula padeniana has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ355041.1 ↗262 bpUSA · 1937

ACGT

GAACGCACATTGCGCCTTCTGGTATTCCGGGAGGCATGCCTGTTCGAGCGTCATCAAACACATTCTCAAGCCCATTTTGCTTGGTCTTGG …

Urnula padeniana clone 5130 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS7

fungal barcode

08Occurrence & distribution

Record type337 records

Wild obs. + sensor332

Museum / vouchered5

Range

Area of Occupancy AOO1 112 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤100 m 122≤1 km 55≤10 km 55>10 km 49

281 georeferenced · 51 without coordinates

Open the mapobservation + sensor332

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 1

1 georeferenced · 4 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
WTUlocation not on record	3
FLASlocation not on record	2

2 institutions · 5 of 5 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Urnula padeniana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys2

Verifiable raw sequence linked2

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)