Urena lobata
speciesAt a glance
Occurrence records20 925
Data sources16
Biological traits62
DNA specimens48
eDNA detections29
Sources16 archives
Databases and archives Urena lobata's data was compiled from.
WikipediaWikimedia Foundation9 languages↗
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility20 925 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics48 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources62 traits
Chemical compositionLOTUS · NPASS36 compounds
Occurrence & distributionGBIF20 925 records
Environmental DNA1 datasets · 5 countries29 detections
DNA & barcodingBOLD · NCBI48 specimens
Genome at a glanceCCDB · GIFT2n = 28
01Narrative
Urena lobata, commonly known as Caesarweed or Congo jute, is a tender perennial, variable, erect, ascendant shrub or subshrub measuring up to 0.5 meters to 2.5 meters tall. The stems are covered with minute, star-like hairs and often tinged purple. Considered a weed, it is widely distributed in the tropics, including in Brazil and Southeast Asia.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTAusTraitsTRY
Size & morphology24
Fruit length6 mm
Fruit length max6 mm
Fruit length min4 mm
Fruit width10 mm
Leaf length67.5 mm
⚠ sources differ — AusTraits: 67.5 mm · GIFT: 53.33 mm
Leaf length max122 mm
Leaf length min14 mm
Leaf size3 250 mm²
Leaf width40 mm
⚠ sources differ — AusTraits: 40 mm · GIFT: 55 mm
Leaf width max127 mm
Leaf width min17 mm
Petiole length0.7 cm
Plant height1.79 m
⚠ sources differ — GIFT: 1.79 m · AusTraits: 2.25 m · TRY: 1 m
Plant height max5 m
Plant height min0.4 m
Seed length4 mm
Seed length max4.3 mm
Seed length min3.2 mm
Seed mass15.94 mg
Seed mass max18.57 mg
Seed mass min10.76 mg
Seed width2.68 mm
Seed width max2.3 mm
Seed width min1.5 mm
Life cycle & reproduction14
Deciduousnessdeciduous
Dispersal typeanimal
Flower colourpink
Flowering endvariable
Flowering startvariable
Flowering timenyyyyynnnnnn
Life formsubshrub or shrub
Life spanperennial
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproductive maturity1 years
Resprouting capacitypartial_resprouting
Sex typehermaphrodite
Diet & foraging1
Parasiteindependent
Habitat & environment14
Aquaticterrestrial
Climateseasonally dry tropical
Climberself-supporting
Elevation max2 500 m
Elevation mean1 012 m
Elevation min0 m
Epiphyteterrestrial
Fruit typemericarp
Growth formshrub
Habitat GIFTÁrea Antrópica, Restinga
Leaf compoundnesssimple
Leaf shapeelliptical
Succulenceno
Woodinesswoody
Physiology & chemistry6
Leaf c397 mg/g
Leaf dry-matter content (LDMC)377 mg/g
Leaf n23.71 mg/g
Leaf p3.95 mg/g
Nitrogen fixingnon_nitrogen_fixer
Photosynthetic pathwayC3
Other traits3
Seed height max0.26 mm
Seed height min0.21 mm
Shoot orientationerect
03Chemical composition36 compounds
Compounds documented for Urena lobata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Flavonols20
Flavones3
Neolignans2
Plant xanthones1
Methyl xanthones $ Plant xanthones1
Documented compounds36 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (2R,3S)-3-(hydroxymethyl)-7-methoxy-2-[3-methoxy-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-2,3-dihydro-1-benzofuran-5-carboxylic acid | present | LOTUS | |
| 3,5-dihydroxy-2-(4-hydroxyphenyl)-7-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | NPASS | |
| 5,6,7,8-tetrahydroxy-2-(4-hydroxyphenyl)-3-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxychromen-4-one | present | LOTUS | |
| 5-Hydroxy-2-(4-hydroxyphenyl)-7-(3,4,5-trihydroxy-6-methyloxan-2-yl)oxy-6-(3,4,5-trihydroxyoxan-2-yl)oxychromen-4-one | present | LOTUS | |
| 5-hydroxy-2-(4-hydroxyphenyl)-7-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxy-6-[(2S,3R,4S,5R)-3,4,5-trihydroxyoxan-2-yl]oxychromen-4-one | present | NPASS | |
| 7-[(2S,3R,4R,5S,6S)-3,5-dihydroxy-6-methyl-4-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one | present | NPASS | |
| 7-[3,5-Dihydroxy-6-methyl-4-[3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-3,5-dihydroxy-2-(4-hydroxyphenyl)chromen-4-one | present | LOTUS | |
| [(2E,6S)-6-hydroxy-2,6-dimethylocta-2,7-dienoyl] 5-[(2S,3R,4S,5S,6R)-3-[(2S,3S,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-4,5-dihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-2-hydroxybenzoate | present | LOTUS | |
| Astragalin | present | NPASS | |
| Astragalin 7-rhamnoside | present | LOTUS |
05DNA & barcoding48 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urena lobata has left across the world's sequence archives.
At a glance
DNA specimens48
Marker genes6
GenBank sequences10
eDNA detections29
Countries5
The DNA barcodea real sequence read deposited for this species
CGATACTTGGTGTGAATTGGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCCAAGCCGTTAGGCCGAGGGCACGTCT …
Urena lobata isolate Sonso1 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL4★rbcLa★ITS6★ITS2trnH-psbA
plant barcodefungal barcodemarker
06Genome at a glanceCCDB · GIFT
The complete instruction manual Urena lobata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× diploid · measured
Chromosome records14–562n range28median28mode13records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 288×CCDB · ipcn-api-dl · CCDB · book-fedorov · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Renard, R., J. Lambinon, M. Reekmans, P. v. Veken & M. Govaert. 1983. Nombres chromosomiques de quelques Angiospermes du Rwanda, du Burundi et du Kenya. Bull. Jard. Bot. Nat. Belg. 53: 342–371.
CCDB · ipcn-api-dl — Huang, S. f., Z. f. Zhao, Z. y. Chen, S. j. Chen & X. x. Huang. 1989. Chromosome counts on one hundred species and infraspecific taxa. Acta Bot. Austro Sin. 5: 161–176.
CCDB · ipcn-api-dl — Cheng, Y. f. & J. l. Tsai. 1999. Chromosome study of the Malvaceae in Taiwan. Quart. J. Forest Res. 21(3): 61–72.
CCDB · ipcn-api-dl — Krishnappa, D. G. & Munirajappa. 1982. In IOPB chromosome number reports LXXVI. Taxon 31: 582–583.
CCDB · ipcn-api-dl — Dasgupta, A. & R. P. Bhatt. 1980. Polygraphic and karyomorphological studies in the genus Urena Linn. J. Cytol. Genet. 15: 123–127.
CCDB · book-fedorov — Skovsted 1935
CCDB · book-fedorov — Ford 1938
GIFT · GIFT (floras)
2n 563×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · GIFT · GIFT (floras)
CCDB · ipcn-api-dl — Guerra, M. d. S. 1986. Citogenetica de Angiospermas coletadas en Pernambuco, I. Revista Brasil. Genét. 9: 21–40.
CCDB · book-ipcn67-71 — KOOTIN-SANWU, M. 1969. In IOPB chromosome number reports XXII. Taxon 18: 433-442.
GIFT · GIFT (floras)
2n 142×CCDB · book-ipcn67-71 · GIFT · GIFT (floras)
CCDB · book-ipcn67-71 — HSU, C.-c. 1967. Preliminary chromosome studies on the vascular plants of Taiwan (I). Taiwania No. 13: 117-130.
GIFT · GIFT (floras)
n 142×CCDB · ipcn-api-dl
CCDB · ipcn-api-dl — Sidhu, M. K., R. C. Gupta & N. Goyal. 1990. SOCGI plant chromosome number reports---IX. J. Cytol. Genet. 25: 145.
CCDB · ipcn-api-dl — Khatoon, S. & S. I. Ali. 1993. Chromosome Atlas of the Angiosperms of Pakistan. Department of Botany, University of Karachi, Karachi.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid1×GIFT · GIFT (floras)
GIFT · GIFT (floras)
polyploid inferred1×PloiDB · family-scale
PloiDB · family-scale — chromEvol; reliability=1.000 ↗
07Deep time~28.5 Ma lineage
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
DNA clock origin28.5 Ma TimeTree
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.
DNA clock origin
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type20 925 records
Wild obs. + sensor14 302
Museum / vouchered5 623
Cultivated / captive15
Other985
Origin
Native494
Introduced30
Range
Area of Occupancy AOO43 584 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy89% within 1 km
≤100 m 7 685≤1 km 1 402≤10 km 726>10 km 424
10 237 georeferenced · 4 065 without coordinates
Open the mapobservation + sensor14 302
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy49% within 1 km
≤100 m 215≤1 km 169≤10 km 300>10 km 98
782 georeferenced · 4 841 without coordinates
Open the institutions mapphysical evidence5 623
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤1 km 1
1 georeferenced · 14 without coordinates
Open the mapnot free-living15
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions143 of 338 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 336 |
| Saint Louis, US | 312 |
| Bronx, US | 224 |
| Brisbane, AU | 185 |
| MeiseBGlocation not on record | 156 |
| Guangzhou, CN | 155 |
| Seoul, KR | 128 |
| Tampa, US | 122 |
| Canberra, AU | 118 |
| Chengdu, CN | 114 |
| Kew, GB | 111 |
| University of Stellenboschlocation not on record | 88 |
| Palmerston, AU | 87 |
| Museo Entomologico de Leonlocation not on record | 75 |
| JBRJlocation not on record | 70 |
| National Biodiversity Institute, Costa Ricalocation not on record | 69 |
| Guilin, CN | 69 |
| Taipei, TW | 68 |
| Xiamen, CN | 68 |
| Taipei, TW | 59 |
| Baroda, IN | 57 |
| Yaoundé, CM | 55 |
| Paris, FR | 54 |
| Chicago, US | 54 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 48 |
| Kunming, CN | 46 |
| WAGlocation not on record | 41 |
| Chengdu, CN | 40 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 40 |
| Chaguaramas, TT | 40 |
| Jena Microbial Resource Collectionlocation not on record | 39 |
| Smithfield, AU | 38 |
| Instituto do Meio Ambientelocation not on record | 38 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 36 |
| Wuhan, CN | 35 |
| Taipei, TW | 33 |
| Laboratorio de Ictiologialocation not on record | 32 |
| Cenargenlocation not on record | 31 |
| Brasília, BR | 30 |
| LBVlocation not on record | 29 |
| UFBAlocation not on record | 29 |
| Miami, US | 28 |
| Plocation not on record | 27 |
| Yangling, CN | 27 |
| TAIElocation not on record | 26 |
| Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record | 25 |
| St. Augustine, TT | 25 |
| Museu Paraense Emílio Goeldilocation not on record | 25 |
| León, NI | 25 |
| LSF/FSA/UAClocation not on record | 24 |
| HNBlocation not on record | 21 |
| Hunan Hupingshan National Nature Reservelocation not on record | 20 |
| Honolulu, US | 19 |
| CASlocation not on record | 19 |
| Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record | 18 |
| Herbier National du Gabonlocation not on record | 18 |
| Masindi, UG | 18 |
| Mount Annan, AU | 18 |
| Istituto Agrario Castelnuovolocation not on record | 18 |
| Leiden University Medical Centerlocation not on record | 17 |
| Durango, MX | 17 |
| UFPElocation not on record | 16 |
| Nagasaki University - Fisherieslocation not on record | 16 |
| Departamento de Sistematica e Ecologialocation not on record | 16 |
| Moscow State Universitylocation not on record | 16 |
| Brasília, BR | 16 |
| Universidade Federal de Sergipe (UFS)location not on record | 16 |
| Kensington, AU | 15 |
| Universidade Federal do Rio Grande do Nortelocation not on record | 15 |
| Stockholm, SE | 15 |
| Edinburgh, GB | 14 |
| MAlocation not on record | 14 |
| Durham, US | 13 |
| INMAlocation not on record | 13 |
| Hangzhou, CN | 13 |
| IPA/SPlocation not on record | 13 |
| Chongqing Museumlocation not on record | 13 |
| UFMSlocation not on record | 13 |
| University of Papua New Guinealocation not on record | 13 |
| Nanjing, CN | 13 |
| UEMlocation not on record | 13 |
| Central China Normal Universitylocation not on record | 13 |
| Instituto de Investigação Científica Tropicallocation not on record | 12 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 12 |
| Salvador, BR | 11 |
| Altos de Pipe, VE | 11 |
| San José, CR | 11 |
| Empresa Pernambucana de Pesquisa Agropecuária, IPAlocation not on record | 11 |
| Auckland, NZ | 11 |
| Yunnan Universitylocation not on record | 11 |
| Cuiabá, BR | 11 |
| Bloomington, US | 10 |
| Adam Mickiewicz University in Poznańlocation not on record | 10 |
| Instituto Nacional de Pesquisas da Amazônia (INPA)location not on record | 10 |
| UnBlocation not on record | 9 |
| USP-IBlocation not on record | 9 |
| Universidade Federal do Maranhãolocation not on record | 9 |
| Chapel Hill, US | 9 |
| Universidad de Nariño (UdeNar)location not on record | 9 |
| Frankfurt am Main | 9 |
| Universidade do Estado de Mato Grossolocation not on record | 9 |
| BRLUlocation not on record | 8 |
| QCNElocation not on record | 8 |
| Feira de Santana, BR | 8 |
| UFESlocation not on record | 8 |
| Dehra Dun, IN | 8 |
| Université du Lomélocation not on record | 8 |
| Dresden, DE | 8 |
| Berlin, DE | 8 |
| UEPAlocation not on record | 8 |
| FJFClocation not on record | 8 |
| UTFPR-CPlocation not on record | 8 |
| Université de Strasbourglocation not on record | 8 |
| Universidad Tecnológica del Chocó (UTCH)location not on record | 8 |
| BISHlocation not on record | 7 |
| Guangxi Agricultural Universitylocation not on record | 7 |
| Chengdu, CN | 7 |
| Campo Mourão, BR | 7 |
| UNESP-ISlocation not on record | 7 |
| Guiyang, CN | 7 |
| Ivano-Frankivsk, UA | 7 |
| Federal University of Espírito Santolocation not on record | 7 |
| Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record | 7 |
| FFPRIlocation not on record | 7 |
| Guizhou Forestry Schoollocation not on record | 6 |
| Mexico City, MX | 6 |
| Jishou Universitylocation not on record | 6 |
| UFMGlocation not on record | 6 |
| Dekalb, US | 6 |
| LDlocation not on record | 6 |
| Area de Conservacion Guanacastelocation not on record | 6 |
| EL PASO, US | 6 |
| Universidade Federal do Ceara, Departamento de Biologialocation not on record | 6 |
| James Cook Townsvillelocation not on record | 6 |
| Universidad Nacional de Colombia (UNAL)location not on record | 6 |
| Aarhus, DK | 6 |
| Chongqing Natural History Museumlocation not on record | 6 |
| TAFORI-LSRClocation not on record | 5 |
| 云南省思茅市民族传统医药研究所location not on record | 5 |
| Guangzhou, CN | 5 |
| UFERSAlocation not on record | 5 |
| CEPLAClocation not on record | 5 |
| Centre National de la Recherche Scientifique et Technologique / Institut de l'environnement et de recherches agricoleslocation not on record | 5 |
| Mexico City, MX | 5 |
| Christchurch, NZ | 5 |
| Uppsala, SE | 5 |
| Changsha, CN | 5 |
| Guiyang, CN | 4 |
| Santa Cruz de la Sierra, BO | 4 |
| FJIDClocation not on record | 4 |
| Adelaide, AU | 4 |
| Wuhan, CN | 4 |
| Santarém, BR | 4 |
| Gujarat Biodiversity Gene Banklocation not on record | 4 |
| Cibinong Science Center, Herbarium Bogorienselocation not on record | 4 |
| Puerto Ayora, EC | 4 |
| National Institute of Biological Resourceslocation not on record | 4 |
| UNESP, Campus São José Rio Prêtolocation not on record | 4 |
| Ann Arbor, US | 4 |
| Davis, US | 4 |
| UFSClocation not on record | 4 |
| Blumenau, BR | 4 |
| UNITINSlocation not on record | 4 |
| IECOSlocation not on record | 4 |
| Brussels, BE | 4 |
| Universidade Federal de Mato Grosso do Sul, Campus do Pantanallocation not on record | 4 |
| UEMAlocation not on record | 4 |
| Xining, CN | 4 |
| Austin, US | 4 |
| CJBGlocation not on record | 4 |
| Centro de Pesquisas Agropecuarias do Tropico Umidolocation not on record | 4 |
| Fortaleza, BR | 4 |
| Universiti Sains Malaysialocation not on record | 4 |
| UNESP-FCAlocation not on record | 4 |
| Tianjin Natural History Museumlocation not on record | 4 |
| Zhejiang Universitylocation not on record | 4 |
| EFGlocation not on record | 4 |
| Zhejiang Museum of Natural Historylocation not on record | 3 |
| HACAMlocation not on record | 3 |
| Bogotá, D.C., CO | 3 |
| “Manash Kozybayev North Kazakhstan University" NPLClocation not on record | 3 |
| Awka, NG | 3 |
| Fort Worth, US | 3 |
| Universidad de Antioquia (UdeA)location not on record | 3 |
| CPATSAlocation not on record | 3 |
| Pondicherry, IN | 3 |
| UNIVASFlocation not on record | 3 |
| Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record | 3 |
| Ypsilanti, US | 3 |
| Jataí / Setor Industrial, BR | 3 |
| Hobart, AU | 3 |
| Cambridge University Herbariumlocation not on record | 3 |
| Burlington, US | 3 |
| John T. Waterhouse Herbariumlocation not on record | 3 |
| Bangkok, TH | 3 |
| Loja, EC | 3 |
| Universidade Federal de Goiáslocation not on record | 3 |
| 黔东南州民族医药研究所标本室location not on record | 3 |
| Cibinong, ID | 3 |
| Llocation not on record | 3 |
| South China Normal Universitylocation not on record | 3 |
| Nanjing, CN | 3 |
| Seychelles National Herbariumlocation not on record | 3 |
| Philadelphia, US | 3 |
| South Kensington, GB | 3 |
| Fujian Institute of Subtropical Botanylocation not on record | 3 |
| Museo universitario di Chietilocation not on record | 3 |
| Shenzhen, CN | 3 |
| Zürich, CH | 3 |
| UFSJlocation not on record | 3 |
| Universidade Federal de Santa Catarinalocation not on record | 3 |
| Glocation not on record | 3 |
| UNESP-IBILCElocation not on record | 2 |
| Institute for Agricultural Research of Mozambiquelocation not on record | 2 |
| Londrina, BR | 2 |
| University of Santo Tomas Museumlocation not on record | 2 |
| Centre National de Floristique - Université Félix HOUPHOUËT-BOIGNYlocation not on record | 2 |
| UNICAMPlocation not on record | 2 |
| Cambridge, US | 2 |
| UESBlocation not on record | 2 |
| Beijing, CN | 2 |
| Jardín Botánico de Cartagena "Guillermo Piñeres" (JBC)location not on record | 2 |
| UFRRJlocation not on record | 2 |
| TNMlocation not on record | 2 |
| Centre National de la Recherche Appliquée au Developement Rurallocation not on record | 2 |
| Elocation not on record | 2 |
| EAlocation not on record | 2 |
| Institut de Recherche Agronomique de Guinée (IRAG)location not on record | 2 |
| Cochabamba, BO | 2 |
| Xian, CN | 2 |
| Station d'Ecologie de Lamtolocation not on record | 2 |
| Hanshan Normal Universitylocation not on record | 2 |
| EMTCMlocation not on record | 2 |
| US | 2 |
| Jardim Botânico do Rio de Janeirolocation not on record | 2 |
| Cruz das Almas, BR | 2 |
| Maringá, BR | 2 |
| CNF-UFHBlocation not on record | 2 |
| Pretoria, ZA | 2 |
| Fredericksburg, US | 2 |
| Southwest Forestry Collegelocation not on record | 2 |
| Wlocation not on record | 2 |
| Sri Ramaswamy Memorial Universitylocation not on record | 2 |
| INBIOlocation not on record | 1 |
| HUAlocation not on record | 1 |
| Porto Velho, BR | 1 |
| Nanjing, CN | 1 |
| Shanghai, CN | 1 |
| HUT Culture Collectionlocation not on record | 1 |
| Claremont, US | 1 |
| Daubeny Herbarium, Oxfordlocation not on record | 1 |
| Nagano City, JP | 1 |
| Universidad Nacional Federico Villarreallocation not on record | 1 |
| Universidade Federal de Pernambucolocation not on record | 1 |
| Paleontological Collectionlocation not on record | 1 |
| UFPRlocation not on record | 1 |
| Universidade de São Paulolocation not on record | 1 |
| Zlocation not on record | 1 |
| Museum of Zoologylocation not on record | 1 |
| Conservatoire Botanique National de Mascarinlocation not on record | 1 |
| Limbe Botanical & Zoological Gardenslocation not on record | 1 |
| UNICAPlocation not on record | 1 |
| Wuzhou, CN | 1 |
| Collections de la Faculte des Sciences de Lyonlocation not on record | 1 |
| Leena Phuphathanaphonglocation not on record | 1 |
| FUNEDlocation not on record | 1 |
| Minia, EG | 1 |
| GAlocation not on record | 1 |
| Cascavel, BR | 1 |
| ESALQlocation not on record | 1 |
| UNEMATlocation not on record | 1 |
| Uberlândia, BR | 1 |
| Vancouver, CA | 1 |
| Chapingo, MX | 1 |
| Nnamdi Azikiwe University Herbarium (NAUH)location not on record | 1 |
| Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record | 1 |
| Northeastern Forestry Universitylocation not on record | 1 |
| Lanzhou, CN | 1 |
| Shanghai, CN | 1 |
| Armidale, AU | 1 |
| Xiangtan City, CN | 1 |
| Cusco, PE | 1 |
| Universidad de Guayaquillocation not on record | 1 |
| Shanghai Chenshan Botanical Gardenlocation not on record | 1 |
| University of Oxfordlocation not on record | 1 |
| Ojo, NG | 1 |
| Goucher Collegelocation not on record | 1 |
| Río Palenque Science Centerlocation not on record | 1 |
| Iquitos, PE | 1 |
| Unknownlocation not on record | 1 |
| Lima, PE | 1 |
| xFRYXELLlocation not on record | 1 |
| arosemena tola, EC | 1 |
| Ilhéus, BR | 1 |
| 武陵山动植物研究所location not on record | 1 |
| Calabar, NG | 1 |
| Forestry Research Institute of Nigerialocation not on record | 1 |
| Servico de Microbiologia e Imunologialocation not on record | 1 |
| Managua, NI | 1 |
| Millersville, US | 1 |
| Zhuzhou, CN | 1 |
| Helsinki, FI | 1 |
| Kagoshima, JP | 1 |
| LGlocation not on record | 1 |
| Cincinnati, US | 1 |
| Madison, US | 1 |
| LISClocation not on record | 1 |
| Université National du Béninlocation not on record | 1 |
| San Angelo, US | 1 |
| Universidad Industrial de Santander (UIS)location not on record | 1 |
| Instituto para la Investigación y la Preservación del Patrimonio Cultural y Natural del Valle del Cauca - INCIVAlocation not on record | 1 |
| Richmond, US | 1 |
| Shanxi Universitylocation not on record | 1 |
| Uniwersytet Jagiellońskilocation not on record | 1 |
| Chadron, US | 1 |
| Tuscaloosa, US | 1 |
| Department of Plant Resources, National Herbarium and Plant Laboratorieslocation not on record | 1 |
| Valdosta State Universitylocation not on record | 1 |
| West China Subalpine Botanical Gardenlocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| HUENFlocation not on record | 1 |
| BAYLUlocation not on record | 1 |
| Riobamba, EC | 1 |
| Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record | 1 |
| Museo naturalistico del Frignano Ferruccio Minghellilocation not on record | 1 |
| University of Hamburglocation not on record | 1 |
| Clocation not on record | 1 |
| GENTlocation not on record | 1 |
| La Paz, BO | 1 |
| Universidad Juárez Autónoma de Tabascolocation not on record | 1 |
| BMlocation not on record | 1 |
| Ural Federal University "B. N. Yeltsin"location not on record | 1 |
| Clemson, US | 1 |
| ASUlocation not on record | 1 |
| UFAClocation not on record | 1 |
| JBPlocation not on record | 1 |
| Montréal, CA | 1 |
| Guiyang, CN | 1 |
338 institutions · 5 071 of 5 623 vouchered records shown · 551 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Urena lobata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map5 countries0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median25.1 °C 23.2–26.3
Seasonal swing summer↔winter2.90 °C
Max temp (day)29.5 °C 25.6–31.0
Min temp (night)21.2 °C 16.4–22.6
Precipitation160 mm/mo 36.0–288
Air humidity67.7 % 47.8–75.0
Moisture balance26.3 mm/mo -88.7–179
Vapour deficit1,080 Pa 717–1,640
Wind speed1.50 m/s 1.20–3.40
Cloud cover31.2 % 6.00–57.6
CHELSA 1981–2010, ~9 km grid, at location & month of 15 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.