Urceola micrantha

(Wall. ex G.Don) D.J.Middleton · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Urceola

At a glance

Occurrence records440

Data sources9

Biological traits11

DNA specimens5

eDNA detections5

Sources9 archives

Databases and archives Urceola micrantha's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility440 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS9 compounds

Occurrence & distributionGBIF440 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD · NCBI5 specimens

01Narrative

Urceola micrantha is a plant species in the genus Urceola. It is a shrub widespread across much of East Asia, Southeast Asia, and the Himalayas. In Taïwan, it is used in folk medicine as an analgesic, antiphlogistic and spasmolytic agent.Proanthocyanidins – a final frontier in flavonoid research? Richard A. Dixon, De-Yu Xie and Shashi B. Sharma, New Phytologist (2005) 165: 9–28 The species contains proanthocyanidin B2, proanthocyanidin A1 and proanthocyanidin A2.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology1

Plant height50 m

Life cycle & reproduction3

Deciduousnessevergreen

Life formclimber

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: Climber

Woodinesswoody

⚠ sources differ — TRY: woody · GIFT: variable

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition9 compounds

Compounds documented for Urceola micrantha across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile2 classes

Proanthocyanins8

Flavan-3-ols1

Documented compounds9 total

Tissue Source Quantified only

Compound	Amount	Source
(1R,7S,15R,19R,26R,27R,31R,32R)-7,19,27-tris(3,4-dihydroxyphenyl)-6,8,18,20,28-pentaoxaoctacyclo[17.11.1.17,15.02,17.05,16.09,14.021,30.024,29]dotriaconta-2(17),3,5(16),9,11,13,21(30),22,24(29)-nonaene-3,11,13,23,26,31,32-heptol	present	LOTUS
Aesculitannin C	present	LOTUS
alpha-Catechin	present	LOTUS
Epicatechin-(2beta->7,4beta->8)-epicatechin-(4beta->8)-epicatechin	present	LOTUS
epicatechin-(2beta->O->7,4beta->8)-ent-epicatechin	present	LOTUS
Epicatechin-(4beta-->8,2beta-->O-->7)catechin	present	LOTUS
Proanthocyanidin A1	present	LOTUS
Procyanidin A2	present	LOTUS
Procyanidin B2	present	LOTUS

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Urceola micrantha has left across the world's sequence archives.

At a glance

DNA specimens5

Marker genes3

GenBank sequences5

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMF350524.1 ↗692 bp

ACGT

CTTATCATTTAGAGGAAGGAGAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAATCCTACAAAGTAGACAAC …

Urceola micrantha voucher A:D. J. Middleton et al. 1003 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type440 records

Wild obs. + sensor197

Museum / vouchered243

Range

Area of Occupancy AOO776 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy96% within 1 km

≤100 m 113≤1 km 18≤10 km 3>10 km 3

137 georeferenced · 60 without coordinates

Open the mapobservation + sensor197

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 3

3 georeferenced · 240 without coordinates

Open the institutions mapphysical evidence243

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Guangzhou, CN	133
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	32
Yangling, CN	9
Saint Louis, US	8
Bronx, US	7
Xiamen, CN	7
Changsha, CN	5
Paris, FR	3
Kew, GB	3
Edinburgh, GB	2
Servico de Microbiologia e Imunologialocation not on record	2
Nishihara, JP	2
South Kensington, GB	2
Taipei, TW	2
Cambridge, US	1
Tsukuba, JP	1
Vietnam Academy of Science and Technology (VAST)location not on record	1
GZUlocation not on record	1
Zhengzhou, CN	1

19 institutions · 222 of 243 vouchered records shown · 20 without an institution code

09Environmental DNA5 detections

Where the DNA of Urceola micrantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.0 °C 10.0–10.0

Seasonal swing summer↔winter31.5 °C

Max temp (day)15.7 °C

Min temp (night)3.10 °C

Precipitation13.8 mm/mo

Air humidity45.7 %

Moisture balance-95.2 mm/mo

Vapour deficit827 Pa

Wind speed4.50 m/s

Cloud cover24.1 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)