Uncaria gambir

(W.Hunter) Roxb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Rubiaceae/Uncaria

At a glance

Occurrence records59

Data sources10

Biological traits11

DNA specimens7

eDNA detections5

Sources10 archives

Databases and archives Uncaria gambir's data was compiled from.

WikipediaWikimedia Foundation11 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility59 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS76 compounds

Occurrence & distributionGBIF59 records

Environmental DNA1 datasets · 0 countries5 detections

DNA & barcodingBOLD · NCBI7 specimens

01Narrative

Uncaria gambir, the gambier or gambir, is a species of plant in the genus Uncaria found in Southeast Asia, mainly Malaysia and Indonesia.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction4

Deciduousnessevergreen

Life formclimbing shrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment5

Climatewet tropical

Climberobligatory

Epiphyteterrestrial

Growth formshrub

⚠ sources differ — GIFT: shrub · TRY: climber

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition76 compounds

Compounds documented for Uncaria gambir across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

🍽 Used in cooking

Compound class profile5 classes

Proanthocyanins10

Arylnaphthalene and aryltetralin lignans9

Flavan-3-ols7

Corynanthe type $ Simple indole alkaloids5

Ursane and Taraxastane triterpenoids4

Documented compounds76 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Rotundifolone	present	NPASS
(+)-Ursolic Acid	present	NPASS
(-)-Catechol	present	NPASS
(2R)-2-(2-phenylethyl)-2,3-dihydrochromen-4-one	present	NPASS
(2R,2'R,3R,3'S,4R)-2'-(3,4-Dihydroxyphenyl)-3,3',4,4'-tetrahydro-2-(4-hydroxyphenyl)(4,8'-bi-2H-1-benzopyran)-3,3',5,5',7,7'-hexol	present	NPASS
(2R,3S)-2-(3,4-dihydroxyphenyl)-8-[(2S,3R,4R)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	NPASS
(2S,3S)-2-(3,4-dihydroxyphenyl)-8-[(2R,3S,4S)-2-(3,4-dihydroxyphenyl)-3,5,7-trihydroxy-3,4-dihydro-2H-chromen-4-yl]-3,4-dihydro-2H-chromene-3,5,7-triol	present	LOTUS
1,2-Benzenediol	present	NPASS
1,5-Diphenylpentan-3-ol	present	NPASS
2-(3,4-dihydroxyphenyl)-3,4-dihydro-2H-1-benzopyran-3,5,7-triol	present	NPASS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Uncaria gambir has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes2

GenBank sequences10

eDNA detections5

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPZ274731.1 ↗623 bpIndonesia · 2024

ACGT

TTGTCGAATCCTGCGAAACGCACGACCGCGAACCTGTGTGAACAATCGGGCGTCGGGTGGTAGGGGAGACTAAGCCCTCCATTCCCACCC …

Uncaria gambir isolate Riau Kecil2 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL★ITS10

plant barcodefungal barcode

08Occurrence & distribution

Record type59 records

Wild obs. + sensor13

Museum / vouchered46

Range

Area of Occupancy AOO164 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy78% within 1 km

≤100 m 5≤1 km 2>10 km 2

9 georeferenced · 4 without coordinates

Open the mapobservation + sensor13

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 46 records without

Open the institutions mapphysical evidence46

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
MeiseBGlocation not on record	7
Kew, GB	2
Cibinong Science Center, Herbarium Bogorienselocation not on record	2
University of Stellenboschlocation not on record	1

4 institutions · 12 of 46 vouchered records shown · 34 without an institution code

09Environmental DNA5 detections

Where the DNA of Uncaria gambir was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)