Umbilicaria esculenta

(Miyoshi) Minks · species

image placeholder — illustration coming later

Fungi/Ascomycota/Lecanoromycetes/Umbilicariales/Umbilicariaceae/Umbilicaria

At a glance

Occurrence records310

Data sources11

Biological traits0

DNA specimens81

eDNA detections81

Sources11 archives

Databases and archives Umbilicaria esculenta's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility310 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI81 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics81 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Chemical compositionLOTUS · NPASS54 compounds

Occurrence & distributionGBIF310 records

Environmental DNA1 datasets · 0 countries81 detections

DNA & barcodingBOLD · NCBI81 specimens

01Narrative

Umbilicaria esculenta is a lichen of the genus Umbilicaria that grows on rocks, also known as rock tripe. It can be found in East Asia including in China, Japan, and Korea. It is edible when properly prepared and has been used as a food source and medicine. It is called iwatake (kanji: 岩茸 or 石茸) in Japanese and seogi (hangul: 석이; hanja: 石耳; literally "stone ear" or "rock ear") or seogi beoseot (hangul: 석이버섯; literally "stone ear mushroom") in Korean. The species name is based on the earlier basionym Gyrophora esculenta.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

03Chemical composition54 compounds

Compounds documented for Umbilicaria esculenta across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Flavonols8

Depsides5

Simple phenolic acids4

Flavan-3-ols3

Flavones3

Documented compounds54 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-taxifolin	present	NPASS
(1R,8S,9R,16R,18S,27S)-9-(3,4-dihydroxyphenyl)-5,8,16,21,23-pentahydroxy-2,10,17,26-tetraoxaheptacyclo[14.11.1.01,13.03,12.06,11.018,27.020,25]octacosa-3(12),4,6(11),13,20,22,24-heptaen-15-one	present	NPASS
(E)-N-(2-hydroxyethyl)-3-[(S)-methylsulfinyl]prop-2-enamide	present	NPASS
(S)-Naringenin	present	NPASS
2'-Methylisoliquiritigenin	present	NPASS
2-beta-d-Glucopyranosyloxy-5-butoxyphenylacetic acid	present	NPASS
2-Hydroxy-4-[2-hydroxy-6-methyl-4-(3,4,6-trihydroxy-2-methylbenzoyl)oxybenzoyl]oxy-6-methylbenzoic acid	present	LOTUS
2-Hydroxy-5-butoxyphenylacetic acid	present	NPASS
4-Carboxy-3-hydroxy-5-methylphenyl 4-((2,4-dihydroxy-6-methylbenzoyl)oxy)-2-hydroxy-6-methylbenzoate	present	LOTUS
5-hydroxy-2-[5-hydroxy-4-methoxy-2-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyphenyl]-3,7-dimethoxychromen-4-one	present	NPASS

05DNA & barcoding81 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Umbilicaria esculenta has left across the world's sequence archives.

At a glance

DNA specimens81

Marker genes2

GenBank sequences10

eDNA detections81

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKP226200.1 ↗493 bp

ACGT

AAGAGATAGGGCCCTCTCTGGGCCCGACCCTCCAACCCTTTGTCTACCTTACCTTCGTTGCTTTGGCGGGCCCGCTGGGGATGACCCACC …

Umbilicaria esculenta isolate TC1403 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS10★ITS1

fungal barcode

08Occurrence & distribution

Record type310 records

Wild obs. + sensor10

Museum / vouchered300

Range

Area of Occupancy AOO540 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 1

1 georeferenced · 9 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤100 m 1≤1 km 2≤10 km 10>10 km 2

15 georeferenced · 285 without coordinates

Open the institutions mapphysical evidence300

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Bando, JP	178
Durham, US	44
Nagatoro-machi, Chichibu-gun, JP	13
LDlocation not on record	12
Chinese Academy of Scienceslocation not on record	10
Madison, US	8
Uppsala, SE	6
DOI/NPS, Colonial National Historical Parklocation not on record	5
Bronx, US	3
Berlin, DE	3
ASUlocation not on record	3
Stockholm, SE	2
Chicago, US	2
Olocation not on record	2
Senckenberg Gesellschaft für Naturforschung: Senckenberg Forschungsinstitut und Naturmuseumlocation not on record	1
Bergen, NO	1
US	1
Wlocation not on record	1
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
South Kensington, GB	1
University of Stellenboschlocation not on record	1
PHlocation not on record	1

22 institutions · 299 of 300 vouchered records shown · 1 without an institution code

09Environmental DNA81 detections

Where the DNA of Umbilicaria esculenta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found81

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 81 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)