Ulvaria obscura

(Kützing) Gayral ex Bliding · species

image placeholder — illustration coming later

Plantae/Chlorophyta/Ulvophyceae/Ulvales/Ulvaceae/Ulvaria

At a glance

Occurrence records1 345

Data sources6

Biological traits0

DNA specimens1

eDNA detections3

Sources6 archives

Databases and archives Ulvaria obscura's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 068 records↗

OBISOcean Biodiversity Information System277 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF · OBIS1 345 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD · NCBI1 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulvaria obscura has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences10

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR734720.1 ↗364 bp

ACGT

GTTTTAACCCCTGAACATAACTGACCTGAAACAGACTCGCATGGGGACACCCCTGCGACCTAACTGAGACAACTCTCAACAACGGATATC …

Ulvaria obscura voucher UK015 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL8★ITS2tufA

plant barcodefungal barcodemarker

08Occurrence & distribution

Record type1 345 records

Wild obs. + sensor124

Museum / vouchered1 019

Other202

Range

Area of Occupancy AOO1 496 km²

Depth

0–200 m sunlit9

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 5.5 m · max 5.5 m · 9 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 9≤1 km 7

16 georeferenced · 108 without coordinates

Open the mapobservation + sensor124

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy88% within 1 km

≤100 m 69≤1 km 682≤10 km 104>10 km 3

858 georeferenced · 161 without coordinates

Open the institutions mapphysical evidence1 019

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions13 of 22 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Durham, US	832
Institut Francais pour l'Etude de la Merlocation not on record	19
Vancouver, CA	13
Bronx, US	12
Chapel Hill, US	7
Corvallis, US	5
Trondheim, NO	5
WTUlocation not on record	3
Madrid, ES	2
TROMlocation not on record	2
Friday Harbor Laboratories, University of Washingtonlocation not on record	2
South Kensington, GB	2
National Marine Biodiversity Institute of Korealocation not on record	2
Barcelona, ES	1
486location not on record	1
Burlington, US	1
University of Stellenboschlocation not on record	1
University of Washingtonlocation not on record	1
Edmonton, CA	1
LDlocation not on record	1
Bourges, FR	1
San Diego, US	1

22 institutions · 915 of 1 019 vouchered records shown · 97 without an institution code

09Environmental DNA3 detections

Where the DNA of Ulvaria obscura was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

drift

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median12.0 °C 12.0–12.0

Seasonal swing summer↔winter8.00 °C

Max temp (day)13.2 °C

Min temp (night)11.1 °C

Precipitation31.3 mm/mo

Air humidity59.3 %

Moisture balance-83.2 mm/mo

Vapour deficit568 Pa

Wind speed2.20 m/s

Cloud cover40.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Ulvaria obscura

At a glance

Sources6 archives

At a glance

Record type1 345 records

Range

Depth

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions13 of 22 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 345 records