Ulmus pumila
speciesAt a glance
Occurrence records16 572
Data sources13
Biological traits120
DNA specimens21
eDNA detections11
Sources13 archives
Databases and archives Ulmus pumila's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility16 571 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI11 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics21 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
Paleobiology DatabasePBDB consortiumfossil record↗
WikidataWikimedia Foundationstructured facts↗On this page8 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources120 traits
Chemical compositionLOTUS · NPASS24 compounds
Occurrence & distributionGBIF · PBDB16 572 records
Environmental DNA1 datasets · 3 countries11 detections
DNA & barcodingBOLD · NCBI21 specimens
Genome at a glanceCCDB2n = 28
Deep timePBDB1 fossils
01Narrative
L'Orme de Sibérie est une espèce de plantes à fleurs de la famille des Ulmacées. C'est un arbre à ne pas confondre avec le Faux Orme de Sibérie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology11
Fruit length16 mm
Fruit length max20 mm
Fruit length min12 mm
Leaf size912 mm²
Plant height21 m
⚠ sources differ — GIFT: 21 m · USDA: 21.34 m · TRY: 19.35 m
Plant height max25 m
Plant height min1 m
Seed length4.33 mm
Seed mass6.24 mg
⚠ sources differ — TRY: 6.24 mg · GIFT: 6.61 mg
Seed mass max6.9 mg
Seed mass min4.2 mg
Life cycle & reproduction29
Bloom periodMid Spring
Coppice potentialNo
Deciduousnessdeciduous
Dispersal typewind
Flower colourgreen
Flower conspicuousNo
Flowering endApr
Flowering startMar
Fruit seed period beginSpring
Fruit seed period endSpring
Growth rate USDARapid
Life formtree
Life spanperennial
Lifespan categoryShort
Propagated by bare rootYes
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedYes
Propagated by sodNo
Propagated by sprigsNo
Propagated by tubersNo
Raunkiær life formphanerophyte
Resprout abilityYes
Seed spread rateModerate
Seedling vigorHigh
Sex typehermaphrodite
Vegetative spread rateNone
Diet & foraging1
Parasiteindependent
Habitat & environment29
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsYes
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Elevation max2 500 m
Elevation mean1 750 m
Elevation min1 000 m
Epiphyteterrestrial
Foliage colorGreen
Foliage porosity summerDense
Foliage porosity winterPorous
Foliage textureMedium
Fruit colourbrown
Growth formtree
Growth form USDASingle Stem
Hedge toleranceMedium
Known allelopathNo
Leaf formovate
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min24 in
Shape and orientationErect
Small grainNo
Woodinesswoody
Physiology & chemistry25
Anaerobic toleranceNone
C:N ratioHigh
Caco3 toleranceLow
Cold stratification requiredYes
Drought toleranceHigh
Fertility requirementMedium
Fire resistantNo
Fire toleranceLow
Frost free days min90 days
Leaf c443 mg/g
Leaf dry-matter content (LDMC)482 mg/g
Leaf n25.51 mg/g
Leaf p1.64 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max50 in
Precipitation min16 in
Salinity toleranceMedium
Shade toleranceHigh
Soil pH max8 pH
Soil pH min5.5 pH
Specific leaf area (SLA)8.4 mm²/mg
Temperature min-38 °F
Wood density544 mg/cm³
⚠ sources differ — TRY: 544 mg/cm³ · GIFT: 639 mg/cm³
Uses & economy15
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityRoutinely Available
Fodder productNo
Fuelwood productMedium
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable browse animalLow
Palatable humanNo
Post productNo
Pulpwood productNo
Seeds per pound64 960 per lb
ToxicityNone
Veneer productNo
Other traits10
Fall conspicuousNo
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Height at 20yr12.19 m
Leaf margintoothed
Leaf spinesno
Leaf thornsno
Planting density max800 per acre
Planting density min300 per acre
03Chemical composition24 compounds
Compounds documented for Ulmus pumila across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Oleanane triterpenoids6
Bauerane triterpenoids3
Flavones2
Flavonols2
Friedelane triterpenoids2
Documented compounds24 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1S,3S,4aS,6aS,6bS,8aR,11R,12S,12aR,14aS,14bR)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,7,8,9,10,11,12,12a,13,14,14a-tetradecahydro-1H-picene-1,3-diol | present | LOTUS | |
| (1S,3S,4aS,6aS,6bS,8aR,11R,12S,12aR,14bS)-4,4,6a,6b,8a,11,12,14b-octamethyl-2,3,4a,5,7,8,9,10,11,12,12a,13-dodecahydro-1H-picene-1,3-diol | present | LOTUS | |
| (4aS,6aR,6aS,6bR,8aR,10R,11R,12aR,14bR)-10,11-dihydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4aS,6aS,6aS,6bR,8aS,10S,12aR,14bR)-10-hydroxy-2,2,6a,6b,9,9,12a-heptamethyl-1,3,4,5,6,6a,7,8,8a,10,11,12,13,14b-tetradecahydropicene-4a-carboxylic acid | present | LOTUS | |
| (4R)-4,8,12-trimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8-tetraene-10,11-dione | present | LOTUS | |
| [(1S,2R,4aR,6aS,6aS,8aS,10R,12aS,13R,14aS,14bR)-10-hydroxy-1,2,4a,6a,9,9,12a,14a-octamethyl-12-oxo-1,2,3,4,5,6,6a,8,8a,10,11,13,14,14b-tetradecahydropicen-13-yl] 4-hydroxy-3-methoxybenzoate | present | LOTUS | |
| Arjunolic Acid | present | LOTUS | |
| Astragalin | present | LOTUS | |
| Atalantoflavone | present | NPASS | |
| Camaldulenic acid | present | LOTUS |
05DNA & barcoding21 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus pumila has left across the world's sequence archives.
At a glance
DNA specimens21
Marker genes5
GenBank sequences10
eDNA detections11
Countries3
The DNA barcodea real sequence read deposited for this species
CCGCGTCCTCTTTGTTATATTGGGGGTCGAGGTTTCTCCGGGCCCCGACCCTTCCCGGGCGCTGGCCGCGGCACTGCCGTGCGCCAGCGT …
Ulmus pumila isolate XB_HM735 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK★rbcL★rbcLa★ITS10★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Ulmus pumila carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidydiploid inferred
Chromosome records24–562n range28median28mode10records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 287×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov +1
CCDB · ipcn-api-dl — Li, Z. b., Q. j. Zheng, Z. p. Zhang & Y. m. Zhang. 1997. Karyotype analysis of four species of ser. Glabrae in the genus Ulmus L. Acta Agric. Univ. Henan. 31(2): 137–140.
CCDB · ipcn-api-dl — Kang, X. y., S. Zhang & X. l. Sun. 1996. Study on the karyotype of Ulmus pumila Linn. J. Jilin Forest. Univ. 12(1): 30–32.
CCDB · ipcn-api-dl — Gurzenkov, N. N. 1973. Studies of chromosome numbers of plants from the south of the Soviet Far East. Komarov Lectures. 20: 47–61.
CCDB · eflora
CCDB · book-fedorov — Leliveld 1933
CCDB · book-fedorov — Krijthe 1939
CCDB · book-atlas-flowering-plants — Leliveld 1933
2n 241×CCDB · book-ipcn75-78
CCDB · book-ipcn75-78 — Bochantseva 1972
2n 301×CCDB · book-fedorov
CCDB · book-fedorov — Walker 1932
2n 561×CCDB · book-fedorov
CCDB · book-fedorov — Walker 1932 (Seitz 1951)
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
07Deep time23–5.33 Ma
How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.
At a glance
Fossil range23–5.33 Ma Oligocene, Miocene
Dated fossil finds1
StatusNot recorded since 5.33 Ma
When this lineage existed
How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The solid bar is the fossil range: the span between the oldest and the youngest fossil that palaeontologists have assigned to Ulmus pumila. Above itBeside it, each dot is one dated fossil find — few enough to count, so they are drawn individually rather than as a graph.
fossil range (PBDB)each dot = one dated find
How it livedPBDB
Dietphotoautotroph
08Occurrence & distribution
Record type16 572 records
Wild obs. + sensor13 297
Museum / vouchered2 915
Cultivated / captive189
Fossil1
Other170
Origin
Native53
Introduced358
Range
Area of Occupancy AOO36 640 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy91% within 1 km
≤100 m 7 675≤1 km 1 056≤10 km 361>10 km 503
9 595 georeferenced · 3 702 without coordinates
Open the mapobservation + sensor13 297
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy51% within 1 km
≤100 m 169≤1 km 436≤10 km 541>10 km 35
1 181 georeferenced · 1 734 without coordinates
Open the institutions mapphysical evidence2 915
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1
1 georeferenced · 188 without coordinates
Open the mapnot free-living189
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions132 of 229 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Beijing, CN | 224 |
| Wuzhou, CN | 208 |
| Moscow State Universitylocation not on record | 134 |
| St. Paul, US | 96 |
| Yangling, CN | 80 |
| Madison, US | 77 |
| Saint Louis, US | 64 |
| Allentown, US | 61 |
| Bronx, US | 58 |
| Zhengzhou, CN | 56 |
| Museum of the Rockieslocation not on record | 49 |
| Albuquerque, US | 46 |
| Denver, US | 37 |
| WTUlocation not on record | 35 |
| DOI/NPS, Colonial National Historical Parklocation not on record | 33 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 32 |
| Riverside, US | 31 |
| Spearfish, US | 30 |
| Irkutsk State Universitylocation not on record | 29 |
| Nanjing, CN | 29 |
| Chongqing Museumlocation not on record | 27 |
| Chadron, US | 25 |
| Ann Arbor, US | 25 |
| Mount Pleasant, US | 22 |
| Flagstaff, US | 22 |
| Siouxland Heritage Museumlocation not on record | 22 |
| Claremont, US | 21 |
| EL PASO, US | 21 |
| Xining, CN | 19 |
| Pullman, US | 18 |
| National Institute of Biological Resourceslocation not on record | 18 |
| Toronto, CA | 16 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 16 |
| ifplocation not on record | 15 |
| ASUlocation not on record | 15 |
| Northeastern Forestry Universitylocation not on record | 15 |
| KIRMlocation not on record | 15 |
| Moscow, US | 15 |
| Montréal, CA | 14 |
| Vitoria, ES | 14 |
| Dekalb, US | 14 |
| San Luis Obispo, US | 14 |
| BIO-UNIPIlocation not on record | 14 |
| Jiangxi College of Educationlocation not on record | 14 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Beijing, CN | 13 |
| Bloomington, US | 12 |
| Philadelphia, US | 11 |
| Kunming, CN | 11 |
| Corvallis, US | 11 |
| Green Bay, US | 11 |
| Logan, US | 11 |
| Boise, US | 10 |
| CICYTEXlocation not on record | 10 |
| Chengdu, CN | 10 |
| ENTClocation not on record | 10 |
| Xinxiang, CN | 10 |
| Richmond, US | 9 |
| Durango, US | 9 |
| DOI/NPS, Greenbelt Parklocation not on record | 9 |
| College Park, US | 9 |
| Guangzhou, CN | 9 |
| Chinese Academy of Forestrylocation not on record | 9 |
| Lincoln, US | 9 |
| MAlocation not on record | 9 |
| Burlington, US | 8 |
| Philadelphia, US | 8 |
| Lanzhou, CN | 8 |
| Fort Worth, US | 8 |
| Urumqi, CN | 8 |
| Forest Survey and Design Institute, Forestry Administrative Bureau of Daxinganlinglocation not on record | 8 |
| Central China Normal Universitylocation not on record | 8 |
| Wuhan, CN | 8 |
| Brookings, US | 7 |
| Columbia, US | 7 |
| Rotorua, NZ | 7 |
| New Haven, US | 7 |
| Ischia Marine Centrelocation not on record | 7 |
| McWane Science Centerlocation not on record | 7 |
| València, ES | 7 |
| Orem, US | 7 |
| Inner Mongolia Universitylocation not on record | 7 |
| Williamsburg, US | 7 |
| WNNUlocation not on record | 6 |
| Provo, US | 6 |
| Durango, MX | 6 |
| Anhui Normal Universitylocation not on record | 6 |
| Tampa, US | 6 |
| Missoula, US | 6 |
| Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record | 6 |
| Fayetteville, US | 6 |
| Provincia di Livornolocation not on record | 5 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 5 |
| Austin, US | 5 |
| GMBAlocation not on record | 5 |
| Durham, US | 5 |
| Québec, CA | 5 |
| University of Wisconsinlocation not on record | 5 |
| Chicago, US | 5 |
| Santa Barbara, US | 5 |
| Lord Fairfax Community Collegelocation not on record | 5 |
| Davis, US | 5 |
| Waverly, US | 5 |
| Pocatello, US | 5 |
| Edmonton, CA | 4 |
| Cheney, US | 4 |
| Guilin, CN | 4 |
| BAYLUlocation not on record | 4 |
| Mexico City, MX | 4 |
| Macomb, US | 4 |
| Vancouver, CA | 4 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 4 |
| Otaru, JP | 4 |
| Servico de Microbiologia e Imunologialocation not on record | 4 |
| Shanghai, CN | 4 |
| Kyoto Universitylocation not on record | 4 |
| Bangkok, TH | 4 |
| J. Rusek Collectionlocation not on record | 4 |
| LDlocation not on record | 4 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 3 |
| Taiyuan Normal Universitylocation not on record | 3 |
| DNSMlocation not on record | 3 |
| Salamanca, ES | 3 |
| Herbarium of South China Botanical Gardenlocation not on record | 3 |
| University of Alberta Museumslocation not on record | 3 |
| Saint John, CA | 3 |
| Victoria, CA | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| Kew, GB | 3 |
| Grand Junction, US | 3 |
| CASlocation not on record | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| Whitehorse, CA | 3 |
| IFR-DNFlocation not on record | 3 |
| College of the Atlantic, Museumlocation not on record | 3 |
| Whitewater, US | 3 |
| Kingston, US | 3 |
| Université Lavallocation not on record | 3 |
| Shanxi Institute of Biologylocation not on record | 3 |
| 东北师范大学自然博物馆location not on record | 3 |
| Xian, CN | 3 |
| Pittsburg, US | 3 |
| Beijing Natural History Museumlocation not on record | 2 |
| Uniwersytet Śląski w Katowicachlocation not on record | 2 |
| Port Elizabeth Museum (Bayworld)location not on record | 2 |
| Salzburg, AT | 2 |
| Little Rock, US | 2 |
| Caldwell, US | 2 |
| Phoenix, US | 2 |
| Knoxville, US | 2 |
| Entomological Society of Latvialocation not on record | 2 |
| Shanghai, CN | 2 |
| Tsukuba, JP | 2 |
| Hermosillo, MX | 2 |
| Korea National Arboretumlocation not on record | 2 |
| Mississippi State, US | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| BRNUlocation not on record | 2 |
| Angwin, US | 2 |
| IWEP FEB RASlocation not on record | 2 |
| ISAlocation not on record | 2 |
| 河南豫北黄河故道湿地鸟类国家级自然保护区location not on record | 2 |
| Phyletisches Museum Jenalocation not on record | 2 |
| Cambridge, US | 2 |
| Córdoba, AR | 2 |
| Lanzhou Institute of Desert Research, Academia Sinicalocation not on record | 2 |
| Oskarshamn, SE | 2 |
| BDBClocation not on record | 2 |
| Stockholm, SE | 2 |
| GJOlocation not on record | 2 |
| Irvine, US | 2 |
| Chengdu, CN | 2 |
| Royal Botanical Gardenslocation not on record | 2 |
| FFPRIlocation not on record | 2 |
| Mlocation not on record | 2 |
| San Angelo, US | 1 |
| Santiago de Compostela, ES | 1 |
| Philadelphia, US | 1 |
| Tartu, EE | 1 |
| Chapel Hill, US | 1 |
| Weber State Universitylocation not on record | 1 |
| Awka, NG | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| OLAlocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| San Diego Natural History Museum, Herbariumlocation not on record | 1 |
| PRClocation not on record | 1 |
| Bozeman, US | 1 |
| Guiyang, CN | 1 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 1 |
| Millersville, US | 1 |
| Mérida, MX | 1 |
| Podgorica, ME | 1 |
| Alicante, ES | 1 |
| Badajoz, ES | 1 |
| University of British Columbia, Herbariumlocation not on record | 1 |
| China Agricultural Universitylocation not on record | 1 |
| VALElocation not on record | 1 |
| Pamplona, ES | 1 |
| NoColllocation not on record | 1 |
| Tuscaloosa, US | 1 |
| US | 1 |
| Mexico City, MX | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Zhejiang Universitylocation not on record | 1 |
| Peking Universitylocation not on record | 1 |
| Hangzhou, CN | 1 |
| Strecker Museum, Baylor Universitylocation not on record | 1 |
| Shanxi Universitylocation not on record | 1 |
| University of South Dakotalocation not on record | 1 |
| Wuhan, CN | 1 |
| SDFlocation not on record | 1 |
| Springfield, US | 1 |
| La Paz, BO | 1 |
| Volunteer State Community Collegelocation not on record | 1 |
| The University of Arizonalocation not on record | 1 |
| DOI/NPS, Craters of the Moon National Monument & Preservelocation not on record | 1 |
| University of Stellenboschlocation not on record | 1 |
| Tula State Universitylocation not on record | 1 |
| Karlsruhe, DE | 1 |
| San Diego, US | 1 |
| IPA/SPlocation not on record | 1 |
| Granada, ES | 1 |
| New Brunswick, US | 1 |
| Acadia Universitylocation not on record | 1 |
| Jefferson City, US | 1 |
| USFS/BHSClocation not on record | 1 |
| Chicago, US | 1 |
| Guasave, MX | 1 |
229 institutions · 2 551 of 2 915 vouchered records shown · 356 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA11 detections
Where the DNA of Ulmus pumila was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found11
Studies independent surveys1
Countries3
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 11 detections have coordinates
Open the map3 countries0
Canyon slopes and bottoms with oak forest ov…weedy roadside slope to lakeshore in open.Planted along street.small open sandy beach. Assoc. species: Sali…
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median22.2 °C 15.1–27.6
Seasonal swing summer↔winter24.8 °C
Max temp (day)28.5 °C 19.7–31.2
Min temp (night)16.0 °C 8.50–24.2
Precipitation86.7 mm/mo 19.0–251
Air humidity53.1 % 50.9–63.6
Moisture balance-50.1 mm/mo -135–105
Vapour deficit1,153 Pa 818–1,433
Wind speed2.70 m/s 1.40–2.90
Cloud cover40.2 % 22.5–41.2
CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.