Ulmus lamellosa

Z.Wang & S.L.Chang · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records25

Data sources8

Biological traits15

DNA specimens0

eDNA detections0

Sources8 archives

Databases and archives Ulmus lamellosa's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility25 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF25 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 28

01Narrative

Ulmus lamellosa, commonly called the Hebei elm, is a small deciduous tree native to four Chinese provinces, Hebei, Henan, Nei Mongol, and Shanxi, to the west and south of Beijing.Fu, L., Xin, Y. & Whittemore, A. (2002). Ulmaceae, in Wu, Z. & Raven, P. (eds) Flora of China, Vol. 5 (Ulmaceae through Basellaceae). Science Press, Beijing, and Missouri Botanical Garden Press, St. Louis, USA. [1]

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length30 mm

Fruit length max35 mm

Fruit length min25 mm

Fruit width23.5 mm

Fruit width max27 mm

Fruit width min20 mm

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment4

Climatetemperate

Climberself-supporting

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus lamellosa has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences10

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPV901527.1 ↗487 bpChina · 2018

ACGT

TATGCGAATTATCCTGTGTGAATTGCAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCGAAGCCATCCGGCCGAGGGCA …

Ulmus lamellosa isolate XB_HM2370 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL3★ITS7

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ulmus lamellosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Santamour, F. S. & G. H. Ware. 1997. Chromosome numbers of new Ulmus (elm) taxa introduced from China. Rhodora 99: 148–151.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type25 records

Wild obs. + sensor16

Museum / vouchered9

Range

Area of Occupancy AOO64 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 4≤1 km 1

5 georeferenced · 11 without coordinates

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 9 records without

Open the institutions mapphysical evidence9

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	4
Institute of Applied Ecology, Academia Sinicalocation not on record	1
CASlocation not on record	1
Nanjing, CN	1
Zhengzhou, CN	1

5 institutions · 8 of 9 vouchered records shown · 1 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)