Ulmus glabra
Huds. · speciesAt a glance
Occurrence records316 926
Data sources14
Biological traits44
DNA specimens44
eDNA detections25
Sources14 archives
Databases and archives Ulmus glabra's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility316 926 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI25 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics44 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
GoaTGenomes on a Tree · Sangergenome & karyotype↗
PloiDBPloidy Databasegenome & karyotype
WikidataWikimedia Foundationstructured facts↗
GLoBIGlobal Biotic Interactionsbiotic interactions↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources44 traits
Chemical compositionLOTUS · NPASS29 compounds
Occurrence & distributionGBIF316 926 records
Environmental DNA1 datasets · 5 countries25 detections
DNA & barcodingBOLD · NCBI44 specimens
Genome at a glanceCCDB · GoaT · NCBI2 Gbp
01Narrative
L'Orme de montagne, Orme blanc ou Orme glabre, est une des espèces de plantes à fleurs de la famille des Ulmaceae. C'est un ormes de taille moyenne à grande, à feuillage caduc.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass116 mg
Leaf size3 162 mm²
⚠ sources differ — TRY: 3 162 mm² · LEDA: 3 938 mm² · GIFT: 3 395 mm²
Plant height35 m
⚠ sources differ — GIFT: 35 m · LEDA: 30 m · TRY: 40 m
Plant height generative20 m
Plant height max40 m
Plant height min10 m
Seed length12.78 mm
Seed mass10.12 mg
⚠ sources differ — TRY: 10.12 mg · LEDA: 11.2 mg · GIFT: 11.88 mg
Seed mass max28 mg
Seed mass min7.39 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typewind
Flowering endApr
Flowering startMar
Life formtree
Life spanperennial
Lifespan years385 years
Pollination modeabiotic
Pollination syndromewind
Raunkiær life formphanerophyte
Reproduction asexualabsent
Seed number1
Self fertilizationabsent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment9
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Fruit typeachene
Growth formtree
Habitat GIFTforest
Mycorrhiza typearbuscular
Woodinesswoody
Physiology & chemistry8
Leaf c424 mg/g
Leaf dry-matter content (LDMC)357 mg/g
⚠ sources differ — TRY: 357 mg/g · LEDA: 254 mg/g
Leaf n22.55 mg/g
Leaf p1.88 mg/g
Photosynthetic pathwayC3
Seed longevity index0
Specific leaf area (SLA)14.31 mm²/mg
⚠ sources differ — TRY: 14.31 mm²/mg · LEDA: 18.7 mm²/mg · GIFT: 21.95 mm²/mg
Wood density585 mg/cm³
⚠ sources differ — TRY: 585 mg/cm³ · GIFT: 650 mg/cm³
Other traits1
Diaspore typefruit
03Chemical composition29 compounds
Compounds documented for Ulmus glabra across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Cadinane sesquiterpenoids7
Cycloeudesmane sesquiterpenoids4
Naphthoquinones3
Dicarboxylic acids2
Elemane sesquiterpenoids2
Documented compounds29 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (1R,2R,8S,10S,12R,13S,14S,15S,16S,17R,19S,21S)-5,13,16,24-tetramethyl-9,20-dimethylidene-3,26-dioxanonacyclo[13.11.0.01,23.02,6.02,14.08,13.010,12.016,21.017,19]hexacosa-5,23-diene-4,25-dione | present | NPASS | |
| (1S,7R,8S,9S,10R,12S)-8-hydroxy-4,9-dimethyl-13-methylidene-7-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-6-oxatetracyclo[7.4.0.03,7.010,12]tridec-3-en-5-one | present | NPASS | |
| (3S,8S,9S,10R,13R,14S,17R)-17-((E,2S,5S)-5-Ethyl-6-methylhept-3-en-2-yl)-10,13-dimethyl-2,3,4,7,8,9,11,12,14,15,16,17-dodecahydro-1H-cyclopenta(a)phenanthren-3-ol | present | LOTUS | |
| (4aS,5R,8aR,9aS)-9a-Hydroxy-3,4a,5-trimethyl-2,4,4a,5,6,7,8,8a,9,9a-decahydronaphtho[2,3-b]furan-2,8-dione | present | NPASS | |
| (4aS,5S,8aS,9aR)-5-hydroxy-3,8a-dimethyl-5-[[(2S,3S,4R,5R,6S)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxymethyl]-4a,6,7,8,9,9a-hexahydro-4H-benzo[f][1]benzofuran-2-one | present | NPASS | |
| (4R)-4,8,12-trimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8-tetraene-10,11-dione | present | LOTUS | |
| (4R)-4-hydroxy-3,5,5-trimethyl-4-[(3S)-3-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxybutyl]cyclohex-2-en-1-one | present | NPASS | |
| (5R,8R)-3,8-dimethyl-5-propan-2-yl-5,6,7,8-tetrahydronaphthalen-2-ol | present | LOTUS | |
| (5R,8R)-3-hydroxy-5-methyl-8-propan-2-yl-5,6,7,8-tetrahydronaphthalene-2-carbaldehyde | present | LOTUS | |
| 2-Naphthaldehyde, 3-hydroxy-8-isopropyl-5-methyl- | present | LOTUS |
05DNA & barcoding44 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus glabra has left across the world's sequence archives.
At a glance
DNA specimens44
Marker genes6
GenBank sequences10
eDNA detections25
Countries6
The DNA barcodea real sequence read deposited for this species
TGTAGAATCCCGTGAACCATCGAGTCTTTGAACGCAAGTTGCGCCCAAAGCCATCCGGCCGAGGTCATGTTTTCCTTGGTGTCACACACC …
Ulmus glabra voucher CCDB-18297-A04 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK2★rbcL4★rbcLa★ITS4★ITS1★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB · GoaT · NCBI
The complete instruction manual Ulmus glabra carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size2 019 570 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
THIS GENOME Ulmus glabra2.02 Gb
HUMAN3.2 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 28 n = 14
Ploidy2× / 4× cytotypes
Chromosome records28–562n range28median28mode42records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 2841×GoaT · DTOL Flowering Plants Estimates Kew · GoaT · Kew Plant DNA C-values Database · CCDB · brit-fl +8
GoaT · DTOL Flowering Plants Estimates Kew
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · brit-fl — Montgomery, L., Khalaf, M.K., Bailey, J.P., Gornall, R.J. Watsonia 21: 365-368 (1997)
CCDB · nw-europe-fl — http://wbd.etibioinformatics.nl/bis/flora.php?selected=beschrijving&menuentry=soorten&id=1729
CCDB · fl-europaea — LoVkvist, 1963
CCDB · poland — Pogan E., Czapik R., Jankun A., Kuta E. et al. 1982 a. Further studies in chromosome numbers of Polish Angiosperms. Part XV. Acta Biol. Cracov. Ser. Bot. 24, 91-126.
CCDB · ipcn-api-dl — Pogan, E., R. CZAPIK, A. Jankun & E. Kuta. 1982. Further studies in chromosome numbers of Polish angiosperms. Part XV. Acta Biol. Cracov., Ser. Bot. 24: 113–126.
CCDB · ipcn-api-dl — Mukherjee, A. & G. H. Ware. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 270.
CCDB · ipcn-api-dl — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal. 1997. Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365–368.
CCDB · ipcn-api-dl — Dobea, C., B. Hahn & W. Morawetz. 1997. Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5–43.
CCDB · ipcn-api-dl — Jav|0urková-Jarolímová, V. 1992. In J. M|3esí|3ccek & V. Jav@0urková-Jarolímová, List of Chromosome Numbers of the Czech Vascular Plants. Academia, Praha.
CCDB · eflora
CCDB · book-fedorov — Krause 1931
CCDB · book-fedorov — Leliveld 1933
CCDB · book-fedorov — Maude 1939
CCDB · book-fedorov — D'Amato 1940a
CCDB · book-fedorov — Ekdahl 1941
CCDB · book-fedorov — Delay 1947
CCDB · book-fedorov — IUep~oBa 1959 rpy.[13liHCKaJI, 3axapLeBa 1967 xapLeBa 1967
CCDB · book-fedorov — Sax K. 1933a
CCDB · book-fedorov — Kri 'the 1939
CCDB · book-fedorov — Ek~ahl 1941 .
CCDB · book-fedorov — Eklundh (LOve A., LOve D. 1942b)
CCDB · book-fedorov — Leliveld (D. 1945)
CCDB · book-fedorov — LOve A. 1954b
CCDB · book-fedorov — HHCKall, 3axapLeua 1967
CCDB · book-fedorov — Krijthe 1939
CCDB · book-fedorov — Krause 1930, 1931
CCDB · book-fedorov — Tischler 1934
CCDB · kew — Band SR. (pers. comm. 1984).
CCDB · CromoCat 2015 — Dobeš, C., Hahn, B. & Morawetz, W. (1997). Chromosomenzahlen zur Gefässpflanzen-Flora Österreichs. Linzer Biol. Beitr. 29(1): 5-43.
CCDB · CromoCat 2015 — Javurková-Jarolímová, V. (1992). List of Chromosome Numbers of the Czech Vascular Plants. In J. Mesíccek & V. Javurková-Jarolímová. Academia, Praha Praha
CCDB · CromoCat 2015 — Montgomery, L., M. Khalaf, J. P. Bailey & K. J. Gornal (1997). Contributions to a cytological catalogue of the British and Irish flora, 5. Watsonia 21: 365-368.
CCDB · CromoCat 2015 — Siljak-Yakovlev, S., Pustahija, F., Šoli?, E.M., Boguni?, F., Muratovi?, E., Baši?, N., Catrice, O. & S. C. Brown. (2010). Towards a Genome Size and Chromosome Number Database of Balkan Flora: C-Values in 343 Taxa with Novel Values for 242 Advanced Scienc
CCDB · CromoCat 2015 — M?sí?ek J. et Jarolímová-Jav?rková V. (1992). List of chromosome numbers of the Czech vascular plants. Academia, Praha. p. 1-144.
2n 561×GoaT · Kew Plant DNA C-values Database
GoaT · Kew Plant DNA C-values Database — ↗
n 142×CCDB · ita-fl · CCDB · book-ipcn75-78
CCDB · ita-fl — D'AMATO F. - 1940. Embriologia di Ulmus campestris L.. N. Giorn. Bot. Ital., n.s. , 47(2): 247-263.
CCDB · book-ipcn75-78 — Bochantseva 1972
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
Sequencing statusassembly quality — how far to trust these numbers
Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.
Assembly levelChromosome
Completeness97.5% BUSCO
08Occurrence & distribution
Record type316 926 records
Wild obs. + sensor299 489
Museum / vouchered8 439
Cultivated / captive7 743
Fossil8
Other1 247
Origin
Native27 659
Introduced275
Range
Area of Occupancy AOO319 968 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy63% within 1 km
≤100 m 98 534≤1 km 71 245≤10 km 98 788>10 km 777
269 344 georeferenced · 30 145 without coordinates
Open the mapobservation + sensor299 489
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy39% within 1 km
≤100 m 644≤1 km 1 661≤10 km 3 237>10 km 393
5 935 georeferenced · 2 504 without coordinates
Open the institutions mapphysical evidence8 439
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy62% within 1 km
≤100 m 48≤10 km 12>10 km 17
77 georeferenced · 7 666 without coordinates
Open the mapnot free-living7 743
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions96 of 185 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 3 088 |
| Moscow State Universitylocation not on record | 667 |
| Helsinki, FI | 292 |
| Trondheim, NO | 266 |
| LDlocation not on record | 263 |
| Olocation not on record | 213 |
| BFLlocation not on record | 213 |
| Salzburg, AT | 168 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 167 |
| MeiseBGlocation not on record | 156 |
| KMNlocation not on record | 133 |
| BIO-UNIPIlocation not on record | 103 |
| MAlocation not on record | 92 |
| Tartu, EE | 91 |
| Oskarshamn, SE | 88 |
| Provincia di Livornolocation not on record | 88 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 88 |
| Berlin, DE | 82 |
| Turku, FI | 75 |
| Kuopio, FI | 66 |
| Görlitz, DE | 65 |
| Bergen, NO | 59 |
| Bern, CH | 58 |
| South Kensington, GB | 57 |
| València, ES | 50 |
| Vitoria, ES | 44 |
| Mlocation not on record | 41 |
| Oulu, FI | 40 |
| SLU Artdatabankenlocation not on record | 36 |
| Rotorua, NZ | 32 |
| BRNUlocation not on record | 30 |
| Tallinn, EE | 29 |
| DBF-NHMDlocation not on record | 28 |
| Karlsruhe, DE | 28 |
| BDBClocation not on record | 27 |
| Jyväskylä, FI | 25 |
| Madrid, ES | 25 |
| Adam Mickiewicz University in Poznańlocation not on record | 23 |
| Entomological Society of Latvialocation not on record | 22 |
| IFR-DNFlocation not on record | 22 |
| CJBGlocation not on record | 22 |
| M-Lichenslocation not on record | 21 |
| University of Stellenboschlocation not on record | 19 |
| TROMlocation not on record | 19 |
| Salamanca, ES | 18 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 17 |
| Auckland, NZ | 17 |
| Toronto, CA | 17 |
| Wlocation not on record | 17 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 16 |
| Museum of the Rockieslocation not on record | 15 |
| Uppsala, SE | 15 |
| Porrentruy, CH | 14 |
| Bronx, US | 14 |
| Zürich, CH | 14 |
| Philadelphia, US | 13 |
| Tampere, FI | 13 |
| Museo civico di Storia naturale Giacomo Doria di Genova | Giacomo Doria Natural History Museum in Genoalocation not on record | 13 |
| Tula State Lev Tolstoy Pedagogical Universitylocation not on record | 13 |
| SZUlocation not on record | 13 |
| GZUlocation not on record | 12 |
| Dresden, DE | 12 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 12 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 11 |
| CICYTEXlocation not on record | 11 |
| TUR-Alocation not on record | 10 |
| Acadia Universitylocation not on record | 10 |
| Madrid, ES | 10 |
| Frankfurt am Main | 9 |
| Uniwersytet Warszawskilocation not on record | 9 |
| Barcelona, ES | 9 |
| College of the Atlantic, Museumlocation not on record | 8 |
| Frauenfeld, CH | 8 |
| PRClocation not on record | 8 |
| Porvoo, FI | 8 |
| New Haven, US | 8 |
| Phyletisches Museum Jenalocation not on record | 8 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 8 |
| BClocation not on record | 8 |
| Canadian Department of Agriculturelocation not on record | 7 |
| Glarus, CH | 6 |
| Philadelphia, US | 6 |
| Academy of Sciences of the Republic of Uzbekistanlocation not on record | 6 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 6 |
| University of Trondheim, Museum of Natural History and Archeologylocation not on record | 6 |
| The Tula Region State Institution of Culture "Tula Museum Association"location not on record | 6 |
| Saint Louis, US | 5 |
| Alicante, ES | 5 |
| Uniwersytet Opolskilocation not on record | 5 |
| Pamplona, ES | 5 |
| PrivatHerblocation not on record | 5 |
| Québec, CA | 5 |
| Tula State Universitylocation not on record | 4 |
| National Museum Waleslocation not on record | 4 |
| Granada, ES | 4 |
| Uniwersytet Śląski w Katowicachlocation not on record | 4 |
| Christchurch, NZ | 4 |
| Departamento de Geologia, Universidad de Chilelocation not on record | 4 |
| Zürich, CH | 4 |
| Philadelphia, US | 4 |
| LfUlocation not on record | 4 |
| Saint John, CA | 4 |
| Washington, US | 4 |
| Museu Nacional, Universidade Federal do Rio de Janeirolocation not on record | 4 |
| GJOlocation not on record | 4 |
| Kingston, US | 4 |
| UoB-IBlocation not on record | 3 |
| Natural History Museum Rotterdamlocation not on record | 3 |
| Finnish Museum of Natural Historylocation not on record | 3 |
| BSBIlocation not on record | 3 |
| Montréal, CA | 3 |
| Fulda, DE | 3 |
| Denver, US | 3 |
| Dekalb, US | 3 |
| ISAlocation not on record | 3 |
| Madison, US | 3 |
| Moscow, US | 3 |
| Wuzhou, CN | 3 |
| Durham, US | 3 |
| Burlington, US | 2 |
| Royal Botanic Garden Edinburghlocation not on record | 2 |
| Pamplona, ES | 2 |
| Chongqing Museumlocation not on record | 2 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 2 |
| Nijmegen, NL | 2 |
| NMBU:MINAlocation not on record | 2 |
| H-Wolflocation not on record | 2 |
| Tulane Universitylocation not on record | 2 |
| Tromso University Museumlocation not on record | 2 |
| Wellington, NZ | 2 |
| Boise, US | 2 |
| Namur, BE | 2 |
| Forssa, FI | 2 |
| Ann Arbor, US | 2 |
| Claremont, US | 2 |
| Lincoln, US | 2 |
| Tilburg, NL | 2 |
| BioFokuslocation not on record | 2 |
| Herb. BBGlocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| SWlocation not on record | 1 |
| Badajoz, ES | 1 |
| H-Schuhwlocation not on record | 1 |
| Universidade de Lisboa, Museu Bocagelocation not on record | 1 |
| Taipei, TW | 1 |
| Jaén, ES | 1 |
| Beijing, CN | 1 |
| nbflocation not on record | 1 |
| La Paz, BO | 1 |
| Provo, US | 1 |
| Columbia, US | 1 |
| University of Alberta Museumslocation not on record | 1 |
| University of Genevalocation not on record | 1 |
| Macomb, US | 1 |
| Albuquerque, US | 1 |
| Flagstaff, US | 1 |
| Valparaiso, CL | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Sion, CH | 1 |
| Samara National Research Universitylocation not on record | 1 |
| Xiamen, CN | 1 |
| Podgorica, ME | 1 |
| San Luis Obispo, US | 1 |
| Vancouver, CA | 1 |
| Whitewater, US | 1 |
| Pocatello, US | 1 |
| Kew, GB | 1 |
| Fredericksburg, US | 1 |
| Université Lavallocation not on record | 1 |
| US | 1 |
| Long Beach, US | 1 |
| Fort Worth, US | 1 |
| Bourges, FR | 1 |
| *unvoucheredlocation not on record | 1 |
| CJBNlocation not on record | 1 |
| Mohonk Preservelocation not on record | 1 |
| FLADlocation not on record | 1 |
| Llocation not on record | 1 |
| UIBlocation not on record | 1 |
| WTUlocation not on record | 1 |
| Banyoles, ES | 1 |
| Córdoba, ES | 1 |
| Sevilla, ES | 1 |
| H-AkrKGlocation not on record | 1 |
| Ivano-Frankove, UA | 1 |
185 institutions · 7 892 of 8 439 vouchered records shown · 466 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA25 detections
Where the DNA of Ulmus glabra was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found25
Studies independent surveys1
Countries5
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 25 detections have coordinates
Open the map5 countries0
Open woodland.in park
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median12.7 °C 10.2–16.4
Seasonal swing summer↔winter15.2 °C
Max temp (day)15.2 °C 13.2–18.8
Min temp (night)9.60 °C 6.10–13.5
Precipitation91.3 mm/mo 63.1–182
Air humidity63.6 % 59.2–66.2
Moisture balance-5.50 mm/mo -49.9–101
Vapour deficit549 Pa 476–685
Wind speed4.00 m/s 2.30–4.70
Cloud cover51.3 % 43.6–61.5
CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.