Ulmus elongata

L.K.Fu & C.S.Ding · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records10

Data sources11

Biological traits23

DNA specimens2

eDNA detections1

Sources11 archives

Databases and archives Ulmus elongata's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources23 traits

Occurrence & distributionGBIF10 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Ulmus elongata L. K. Fu & C. S. Ding , also known as the long raceme elm in the US, is a deciduous tree endemic to broadleaf forests in the eastern provinces of China.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology11

Fruit length22.5 mm

Fruit length max25 mm

Fruit length min20 mm

Fruit width3 mm

Fruit width max3 mm

Fruit width min3 mm

Leaf length1 mm

Leaf length max1 mm

Plant height30 m

⚠ sources differ — GIFT: 30 m · TRY: 20 m

Plant height max30 m

Plant height min30 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Lifespan years200 years

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max900 m

Elevation mean575 m

Elevation min250 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus elongata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences4

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMT165929.1 ↗159 165 bp

ACGT

GGCGAACGACGGGAATTGAACCCGCGCATGATGGATTCACAATCCATTGCCTTAATCCACTTGGCTACATCCGCCCTTATTAAAAATTTA …

Ulmus elongata voucher No. 1619020 chloroplast, complete genome

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★rbcL4

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Ulmus elongata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Santamour, F. S. & G. H. Ware. 1997. Chromosome numbers of new Ulmus (elm) taxa introduced from China. Rhodora 99: 148–151.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type10 records

Wild obs. + sensor3

Museum / vouchered7

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

>10 km 2

2 georeferenced · 1 without coordinates

Open the mapobservation + sensor3

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 2

2 georeferenced · 5 without coordinates

Open the institutions mapphysical evidence7

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Museum of the Rockieslocation not on record	2
Wuhan, CN	1
Columbia, US	1
Nanjing, CN	1
Herbarium of South China Botanical Gardenlocation not on record	1

5 institutions · 6 of 7 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Ulmus elongata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median29.2 °C 29.2–29.2

Seasonal swing summer↔winter24.7 °C

Max temp (day)32.0 °C

Min temp (night)26.2 °C

Precipitation264 mm/mo

Air humidity63.0 %

Moisture balance91.8 mm/mo

Vapour deficit1,505 Pa

Wind speed2.90 m/s

Cloud cover40.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)