Ulmus elliptica

K.Koch · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records19

Data sources3

Biological traits10

DNA specimens0

eDNA detections0

Sources3 archives

Databases and archives Ulmus elliptica's data was compiled from.

GBIFGlobal Biodiversity Information Facility19 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements3 literature sources10 traits

Occurrence & distributionGBIF19 records

DNA & barcodingNCBIsequences

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology2

Plant height37.5 m

Seed mass5.78 mg

Life cycle & reproduction3

Deciduousnessdeciduous

Life formtree

Life spanperennial

Habitat & environment3

Climatetemperate

Growth formtree

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

Other traits1

Plant support typefree-standing

05DNA & barcoding3 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus elliptica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences3

The DNA barcodea real sequence read deposited for this species

ITSKC539587.1 ↗559 bp

ACGT

CAGCAGAACGACCCGCGAACACGTTGTTAAATCGGGGGGCGAGGGCTCGGGCCCCGACCCTCCCCCGGGCTGGCCGCGGCCCTGCCGTGT …

Ulmus elliptica voucher MO:G. Gates s.n. internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor8

Museum / vouchered11

Range

Area of Occupancy AOO36 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy63% within 1 km

≤1 km 5>10 km 3

8 georeferenced

Open the mapobservation + sensor8

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 10 without coordinates

Open the institutions mapphysical evidence11

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BClocation not on record	2
Wlocation not on record	2
Berlin, DE	2
Dresden, DE	1
College Park, US	1

5 institutions · 8 of 11 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)