Ulmus davidiana

Planch. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records349

Data sources14

Biological traits34

DNA specimens3

eDNA detections349

Sources14 archives

Databases and archives Ulmus davidiana's data was compiled from.

WikipediaWikimedia Foundation8 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility349 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI349 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources34 traits

Chemical compositionLOTUS · NPASS33 compounds

Occurrence & distributionGBIF349 records

Environmental DNA2 datasets · 6 countries349 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Ulmus davidiana var. japonica, the Japanese elm, is one of the larger and more graceful Asiatic elms, endemic to much of continental northeast Asia and Japan, where it grows in swamp forest on young alluvial soils, although much of this habitat has now been lost to intensive rice cultivation.Makita, H., Miyagi, T., Miura, O., and Kikuchi, T. (1979). A study of an alder forest and an elm forest with special reference to their geomorphological conditions in a small tributary basin. In: Vegetation und Lansdschaft Japans. Bull: Yokohama Phytosoc. Soc. Japan 16, 1979

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology4

Plant height15 m

Seed mass89.1 mg

Seed mass max100 mg

Seed mass min78.2 mg

Life cycle & reproduction7

Deciduousnessdeciduous

Dispersal typewind

Flowering endJun

Flowering startApr

Life formtree

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formtree

Habitat GIFTforest, mountains, rivers

Leaf formcordate

Mycorrhiza typemixed

Woodinesswoody

Physiology & chemistry8

Leaf C:N ratio24.17 g/g

Leaf c440 mg/g

Leaf dry-matter content (LDMC)378 mg/g

Leaf n22.01 mg/g

Leaf p2.62 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)12.8 mm²/mg

Wood density469 mg/cm³

⚠ sources differ — TRY: 469 mg/cm³ · GIFT: 590 mg/cm³

Other traits5

Leaf margintoothed

Leaf spinesno

Leaf thornsno

Sla max17.96 mm²/mg

Sla min8.13 mm²/mg

03Chemical composition33 compounds

Compounds documented for Ulmus davidiana across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Lupane triterpenoids11

Flavan-3-ols5

Cadinane sesquiterpenoids4

Guaiane sesquiterpenoids3

Corynanthe type3

Documented compounds33 total

Tissue Source Quantified only

Compound	Amount	Source
(-)-Catechol	present	LOTUS
(2R,3S)-5-[(2S,3R,4S)-3,4-dihydroxy-4-(hydroxymethyl)oxolan-2-yl]oxy-2-(3,4-dihydroxyphenyl)-3,4-dihydro-2H-chromene-3,7-diol	present	LOTUS
(4R)-4,8,12-trimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8-tetraene-10,11-dione	present	LOTUS
(4R)-4-hydroxy-4,8,12-trimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),5(13),6,8-tetraene-10,11-dione	present	LOTUS
1alpha-Hydroxytorilin	present	LOTUS
1beta-Hydroxytorilin	present	LOTUS
4-(Hydroxymethyl)-8,12-dimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),3,5(13),6,8-pentaene-10,11-dione	present	LOTUS
8-(Dimethoxymethyl)-4,12-dimethyl-2-oxatricyclo[7.3.1.05,13]trideca-1(12),3,5(13),6,8-pentaene-10,11-dione	present	LOTUS
[(5S,6R,8S,8aS)-5-(2-acetyloxypropan-2-yl)-3,8-dimethyl-2-oxo-4,5,6,7,8,8a-hexahydro-1H-azulen-6-yl] (Z)-2-methylbut-2-enoate	present	LOTUS
Acemiko	present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus davidiana has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences10

eDNA detections349

Countries6

The DNA barcodea real sequence read deposited for this species

ITSMW382669.1 ↗633 bp

ACGT

TTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGCGAACACGTTGTTAAATCGGGGGGCGAGGGT …

Ulmus davidiana voucher WYJ201904548 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK5★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ulmus davidiana carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome records28–282n range28median28mode9records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 289×CCDB · ipcn-api-dl · CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · ipcn-api-dl — Mukherjee, A. & G. H. Ware. 1979. In IOPB chromosome number reports LXIII. Taxon 28: 270.

CCDB · ipcn-api-dl — Oginuma, K., P. H. Raven & H. Tobe. 1990. Karyomorphology and relationships of Celtidaceae and Ulmaceae (Urticales). Bot. Mag. (Tokyo) 103: 113–131.

CCDB · book-fedorov — Sax K. 1933a

CCDB · book-fedorov — Funabiki 1958a

CCDB · book-fedorov — Leliveld 1933

CCDB · book-fedorov — Krijthe 1939

CCDB · book-atlas-flowering-plants

CCDB · book-atlas-flowering-plants — Krijthe 1939

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type349 records

Wild obs. + sensor126

Museum / vouchered222

Cultivated / captive1

Range

Area of Occupancy AOO952 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy92% within 1 km

≤100 m 39≤1 km 10>10 km 4

53 georeferenced · 73 without coordinates

Open the mapobservation + sensor126

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy46% within 1 km

≤1 km 17≤10 km 20

37 georeferenced · 185 without coordinates

Open the institutions mapphysical evidence222

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 41 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
KR	35
KIRMlocation not on record	33
Beijing, CN	21
Kunming, CN	15
Kyoto Universitylocation not on record	14
Xining, CN	12
National Institute of Biological Resourceslocation not on record	12
Yangling, CN	10
ifplocation not on record	10
NSMKlocation not on record	5
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	4
Nanjing, CN	4
Herbarium of the Department of Botany, University of Tokyolocation not on record	4
Zhengzhou, CN	4
Chinese Academy of Forestrylocation not on record	3
Xian, CN	2
Northeast Institute of Geography and Agroecology, Chinese Academy of Scienceslocation not on record	2
Taiyuan Normal Universitylocation not on record	2
Beijing, CN	2
CASlocation not on record	2
Zhuzhou, CN	2
Guilin, CN	2
Shanxi Universitylocation not on record	1
Wlocation not on record	1
Tianjin Natural History Museumlocation not on record	1
Beijing Normal Universitylocation not on record	1
Wuhan, CN	1
Nanjing, CN	1
Museum of the Rockieslocation not on record	1
Kew, GB	1
sxphclocation not on record	1
DNSMlocation not on record	1
Peking Universitylocation not on record	1
Rotorua, NZ	1
Xinxiang, CN	1
Guizhou Forestry Schoollocation not on record	1
Shanghai, CN	1
Philadelphia, US	1
Guiyang, CN	1
Inner Mongolia Universitylocation not on record	1
Canadian Department of Agriculturelocation not on record	1

41 institutions · 219 of 222 vouchered records shown · 3 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA349 detections

Where the DNA of Ulmus davidiana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found349

Studies independent surveys2

Countries6

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 349 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.7 °C 5.90–16.8

Seasonal swing summer↔winter22.3 °C

Max temp (day)14.2 °C 8.40–19.8

Min temp (night)6.00 °C 3.60–13.9

Precipitation64.3 mm/mo 56.6–94.4

Air humidity64.4 % 59.4–68.3

Moisture balance5.20 mm/mo -37.6–64.4

Vapour deficit467 Pa 296–726

Wind speed4.20 m/s 2.80–6.60

Cloud cover48.5 % 38.3–60.0

CHELSA 1981–2010, ~9 km grid, at location & month of 324 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)