Ulmus castaneifolia

Hemsl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Rosales/Ulmaceae/Ulmus

At a glance

Occurrence records169

Data sources11

Biological traits19

DNA specimens3

eDNA detections1

Sources11 archives

Databases and archives Ulmus castaneifolia's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility169 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF169 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceCCDB2n = 28

01Narrative

Ulmus castaneifolia Hemsley, the chestnut-leafed elm or multinerved elm, is a small deciduous tree found across much of China in broadleaved forests at elevations of 500 -.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology7

Fruit length24 mm

Fruit length max33 mm

Fruit length min15 mm

Fruit width13 mm

Fruit width max16 mm

Fruit width min10 mm

Plant height20 m

Life cycle & reproduction4

Deciduousnessdeciduous

Life formtree

Life spanperennial

Lifespan years500 years

Habitat & environment7

Climatetemperate

Climberself-supporting

Elevation max1 600 m

Elevation mean1 050 m

Elevation min500 m

Growth formtree

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Ulmus castaneifolia has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences7

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT216840.1 ↗222 bpChina · 2011

ACGT

GGGGCGGATGCTGGCCTCCCGTGAGCCTCGCCTCGCGGCTGGCCCAAATGCGAGATCTCTGCTGCGAGCGTCGCGGCGATGGTGGTTGTC …

Ulmus castaneifolia voucher BOP010307 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Ulmus castaneifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 28 n = 14

Ploidydiploid inferred

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 281×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Santamour, F. S. & G. H. Ware. 1997. Chromosome numbers of new Ulmus (elm) taxa introduced from China. Rhodora 99: 148–151.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type169 records

Museum / vouchered169

Range

Area of Occupancy AOO288 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤100 m 3≤1 km 3

6 georeferenced · 163 without coordinates

Open the institutions mapphysical evidence169

10Collections & institutions

Holding institutions17 of 27 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Beijing, CN	46
Guangzhou, CN	23
Zhuzhou, CN	13
Guilin, CN	13
Central China Normal Universitylocation not on record	7
Guizhou Forestry Schoollocation not on record	7
Changsha, CN	6
Chengdu, CN	5
Wuhan, CN	5
Hangzhou, CN	5
Guiyang, CN	4
Taipei, TW	4
Institute for Agricultural Bacteriology and Fermentation Biologylocation not on record	4
Zhejiang Universitylocation not on record	3
Columbia, US	3
Museum of the Rockieslocation not on record	3
Nanjing, CN	2
CASlocation not on record	2
Xiamen, CN	2
WNNUlocation not on record	2
Yangling, CN	1
Guiyang, CN	1
Guangxi Institute of Traditional Medical and Pharmaceutical Scienceslocation not on record	1
Kunming, CN	1
Jishou Universitylocation not on record	1
Herbarium of South China Botanical Gardenlocation not on record	1
Guangzhou, CN	1

27 institutions · 166 of 169 vouchered records shown · 3 without an institution code

09Environmental DNA1 detections

Where the DNA of Ulmus castaneifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median28.5 °C 28.5–28.5

Seasonal swing summer↔winter19.0 °C

Max temp (day)32.8 °C

Min temp (night)23.2 °C

Precipitation162 mm/mo

Air humidity58.1 %

Moisture balance-18.4 mm/mo

Vapour deficit1,627 Pa

Wind speed2.00 m/s

Cloud cover51.5 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)